View Detailed Record Patient: Code Patient: HAND Status Patient: Sex Patient: Risk Factor Patient: Viral Load At Sampling Patient: CD4 Count At Sampling Patient: HIV Therapy Status Patient: HIV Therapy Months Patient: Age At Sampling Sampling: Year Sampling: Country (City) Sampling: Tissue Sequence: Polyprotein (Protein) Sequence: Genotyping Information* Sequence: Accession Number Sequence: PMID HIV Sequence
View LIUPT48 No HAND Unknown Sex Unknown Risk Factor Unknown Viral Load 47 (+53/-53) cells / ul ZDV 12 (+15/-15) 34 (+6/-6) 1998 Canada (unknown) Brain Pol (RT) B (B) (No) U82096 9718130 cccattagtcctattgagactgtaccagtaaaattaaagccaggaatggatggcccaaaagttaaacaatggcca... more
cccattagtcctattgagactgtaccagtaaaattaaagccaggaatggatggcccaaaagttaaacaatggccattgacagaagaaaaaataaaagcattagtagaaatttgtacagaaatggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagattttagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcctgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaattttagagccttatagaaaacaaaatccagaaatagtcatctatcaatacatggatgatttgtatgtaggatctgacttagaaatagagcagcatagaacaaaaatagaggaactgagacaacatctgttgaggtggggacttaccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggttatgaactccatcctgataaatggaca
View LIUPT66 No HAND Unknown Sex Unknown Risk Factor Unknown Viral Load 47 (+53/-53) cells / ul ZDV 12 (+15/-15) 34 (+6/-6) 1998 Canada (unknown) Brain Pol (RT) B (B) (No) U82097 9718130 cccattagtcctattgaaactgtaccagtaaaattaaagccaggaatggatggcccaaaagtcaaacaatggcca... more
cccattagtcctattgaaactgtaccagtaaaattaaagccaggaatggatggcccaaaagtcaaacaatggccattgacagaagaaaaaataaaagcattagtagaaatttgtacagaaatggaaaaggaaggaaagatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaactttataggagaactctagacttctgggaagttccattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaaaacaacagaaagtatactgcatttaccatacctagtataaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacataattatctatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagacaacatctgttgaagtggggatttaccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggttatgaactccatcctgataaatggaca
View LIUPT09 HAD Unknown Sex Unknown Risk Factor Unknown Viral Load 15 (+14/-14) cells / ul ZDV 19 (+15/-15) 31 (+3/-3) 1998 Canada (unknown) Brain Pol (RT) B (B) (No) U82098 9718130 cccattagtcctattgaaactgtaccagtaaaattaaagccaggaatggatggcccaaaagttaaacaatggcca... more
cccattagtcctattgaaactgtaccagtaaaattaaagccaggaatggatggcccaaaagttaaacaatggccattgacagaagaaaaaataaaagcattattagaaatttgtacagaaatggaaaaggaagggaagatttccaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagatgaagacttcagaaagtatactgcatttaccatacctagtataaacaatgagacaccagggattagatatcagtacaatgtacttccacagggatggaaaggatcacctgcaatattccaaagtagcatgacaaaaatcttagatccttttagaaaacaaaatccagacatggttatctatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagacaacatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggttatgaactccatcctgataaatggaca
There are no records to display
Create filter