View Detailed Record Patient: Code Patient: HAND Status Patient: Sex Patient: Risk Factor Patient: Viral Load At Sampling Patient: CD4 Count At Sampling Patient: HIV Therapy Status Patient: HIV Therapy Months Patient: Age At Sampling Sampling: Year Sampling: Country (City) Sampling: Tissue Sequence: Polyprotein (Protein) Sequence: Genotyping Information* Sequence: Accession Number Sequence: PMID HIV Sequence
View NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174887 10482626 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaac... more
atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
View NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174888 10482626 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaac... more
atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
View NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174889 10482626 atataaattaaaacatataatatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagagac... more
atataaattaaaacatataatatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagagacatcagaaggctgtagacaaatattagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagccagcacgagcaacggcagcagctgccacaagaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
View NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174890 10482626 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaac... more
atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagataccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatca
View NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174891 10482626 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaac... more
atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgaatagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacaaccagcagcagctgccacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatca
View NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174892 10482626 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctagcctgttagaaac... more
atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctagcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatgcagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
View NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 1999 United Kingdom (unknown) Spleen Gag (p17) B (B) (No) AF174893 10482626 atatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaac... more
atatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtacatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaatcaaaagtaagaaaaaagcacagccagcagcagcagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacagcaggccatatcacc
View NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174894 10482626 agggggaaagaaaagatataaattaaagcatatagtatgggcaagcagggaactagaacgattcgcagttaatcc... more
agggggaaagaaaagatataaattaaagcatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtacagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
View NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174895 10482626 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccc... more
agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
View NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174896 10482626 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcc... more
agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcaggaggctatagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
There are no records to display
Create filter