View Detailed Record Patient: Code Patient: HAND Status Patient: Sex Patient: Risk Factor Patient: Viral Load At Sampling Patient: CD4 Count At Sampling Patient: HIV Therapy Status Patient: HIV Therapy Months Patient: Age At Sampling Sampling: Year Sampling: Country (City) Sampling: Tissue Sequence: Polyprotein (Protein) Sequence: Genotyping Information* Sequence: Accession Number Sequence: PMID HIV Sequence
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001147 10076507 tgtacaagacccaacaacaatacaagaaaaggtataaatataggaccagggagaggattattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtataaatataggaccagggagaggattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001163 10076507 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcattattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001164 10076507 tgtacaagacccaacaacaatactagaaaaggtatacatataggaccagggagagcattattttatgcaacagac... more
tgtacaagacccaacaacaatactagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001165 10076507 tgtacaagacccaacaacaatacgagaaaaggtatacatataggaccagggagagcattattttatgcaacagac... more
tgtacaagacccaacaacaatacgagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001166 10076507 tgtacaagacccaacaacaatacaagaaaaggtatacatatagggccagggagagcattattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtatacatatagggccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001167 10076507 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagggcattattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagggcattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001168 10076507 tgtactagacccaacaacaatacaaggaaaggtatacatataggaccagggagagcattattttatgcaacagac... more
tgtactagacccaacaacaatacaaggaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacactgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001169 10076507 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaa... more
atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaggacaggactaaatggagaaaattagta
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001170 10076507 atggaaaaggaaggaaaaatctcacaaattgggtctgaaaatccatacaatactccagtatttggcataaagaaa... more
atggaaaaggaaggaaaaatctcacaaattgggtctgaaaatccatacaatactccagtatttggcataaagaaaaaggacagtactaaatcgagaaaattagta
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001171 10076507 atggaaaaggaaggaaaaatttcacaaattgggcctgaaaatccacacaatactccagtattgggcataaagaaa... more
atggaaaaggaaggaaaaatttcacaaattgggcctgaaaatccacacaatactccagtattgggcataaagaaaaaggacaggactaaatggagaaaattagga
There are no records to display
Create filter