View Detailed Record Patient: Code Patient: HAND Status Patient: Sex Patient: Risk Factor Patient: Viral Load At Sampling Patient: CD4 Count At Sampling Patient: HIV Therapy Status Patient: HIV Therapy Months Patient: Age At Sampling Sampling: Year Sampling: Country (City) Sampling: Tissue Sequence: Polyprotein (Protein) Sequence: Genotyping Information* Sequence: Accession Number Sequence: PMID HIV Sequence
View NA38 HIVE Unknown Sex IV Drug User Unknown Viral Load 3 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Lymph Node Tat (gp160) B (B) (No) AF409416 11689650 ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagctgact... more
ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagctgactaaacctgtaataattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
View NA38 HIVE Unknown Sex IV Drug User Unknown Viral Load 3 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Lymph Node Tat (gp160) B (B) (No) AF409417 11689650 ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgact... more
ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgttttaattaattgtacaagacctagcaacaatacaataaaaggtatacatataagaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
View NA38 HIVE Unknown Sex IV Drug User Unknown Viral Load 3 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Lymph Node Tat (gp160) B (B) (No) AF409418 11689650 ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagttgact... more
ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagttgactaaacctgtaataattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
View NA38 HIVE Unknown Sex IV Drug User Unknown Viral Load 3 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Lymph Node Tat (gp160) B (B) (No) AF409419 11689650 ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagctgact... more
ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagctgactaaacctgtaataattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggaaaaataataggagatataagacaagcacattgtaaccttagtagaataaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
View NA38 HIVE Unknown Sex IV Drug User Unknown Viral Load 3 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Lymph Node Tat (gp160) B (B) (No) AF409420 11689650 ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgact... more
ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacacatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
View NA38 HIVE Unknown Sex IV Drug User Unknown Viral Load 3 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Lymph Node Tat (gp160) B (B) (No) AF409421 11689650 ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgact... more
ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtaataattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
View NA199 Unknown HAND Status Unknown Sex IV Drug User Unknown Viral Load 28 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Colon Tat (gp160) B (B) (No) AF409422 11689650 ctagcagaagaagagatagtaattagatctgaaaatttcacaaacaatgctaaagtaataatagtacagctgaat... more
ctagcagaagaagagatagtaattagatctgaaaatttcacaaacaatgctaaagtaataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
View NA199 Unknown HAND Status Unknown Sex IV Drug User Unknown Viral Load 28 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Colon Tat (gp160) B (B) (No) AF409423 11689650 ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaat... more
ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
View NA199 Unknown HAND Status Unknown Sex IV Drug User Unknown Viral Load 28 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Colon Tat (gp160) B (B) (No) AF409424 11689650 ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaat... more
ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
View NA199 Unknown HAND Status Unknown Sex IV Drug User Unknown Viral Load 28 cells / ul Unknown Therapy Status Unknown Therapy Status Unknown Patient Age 2001 United Kingdom (Edinburgh) Colon Tat (gp160) B (B) (No) AF409425 11689650 ctagcagaagaagaggtagtaattagatctgaaaattttacaaacaatgctaaagtcataatagtacagctgaat... more
ctagcagaagaagaggtagtaattagatctgaaaattttacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtggaacaaaatggaataccactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
There are no records to display
Create filter