sequence and clinical data

Patient: Code Patient: HAND Status Patient: Sex Patient: Risk Factor Patient: Viral Load At Sampling Patient: CD4 Count At Sampling Patient: HIV Therapy Status Patient HIV Therapy Months Patient: Age At Sampling Patient Health At Sampling Sampling: Year Sampling Region Sampling: Tissue Sequence: Polyprotein (Protein) Genotyping Information Sequence: Accession Number SEQUENCE PMID Sequence Length (nt) HIV Sequence
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001137 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001138 10076507 105 tgtacaagacccaataacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001139 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagaggattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001140 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001141 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagatataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001142 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001143 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001144 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001145 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001146 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtgtatatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt