sequence and clinical data

Patient: Code Patient: HAND Status Patient: Sex Patient: Risk Factor Patient: Viral Load At Sampling Patient: CD4 Count At Sampling Patient: HIV Therapy Status Patient HIV Therapy Months Patient: Age At Sampling Patient Health At Sampling Sampling: Year Sampling Region Sampling: Tissue Sequence: Polyprotein (Protein) Genotyping Information Sequence: Accession Number SEQUENCE PMID Sequence Length (nt) HIV Sequence
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001137 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001138 10076507 105 tgtacaagacccaataacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001139 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagaggattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001140 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001141 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagatataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001142 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001143 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001144 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001145 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001146 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtgtatatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001147 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtataaatataggaccagggagaggattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001163 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001164 10076507 105 tgtacaagacccaacaacaatactagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001165 10076507 105 tgtacaagacccaacaacaatacgagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001166 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacatatagggccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001167 10076507 105 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagggcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Tat (gp160) B (#) # AB001168 10076507 105 tgtactagacccaacaacaatacaaggaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacactgt
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001169 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaggacaggactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001170 10076507 105 atggaaaaggaaggaaaaatctcacaaattgggtctgaaaatccatacaatactccagtatttggcataaagaaaaaggacagtactaaatcgagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001171 10076507 105 atggaaaaggaaggaaaaatttcacaaattgggcctgaaaatccacacaatactccagtattgggcataaagaaaaaggacaggactaaatggagaaaattagga
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001172 10076507 105 atggaaaaggaagggaaaatagcacatcttgggcctgataatccatacaatactccagcattgggcataaagaaaaaggacaggactaaatggagaaaattagga
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001173 10076507 105 atggaaaaggaaggaaaaatttcacaaattgggcctgataatccatacaatactctagtatttggcataaagaaaatggataggactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001174 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagataaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001175 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggataaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001176 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggataagaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001177 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaataggacagcataggataaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001178 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggataaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001179 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001180 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaagaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001181 10076507 105 ttagaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001182 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001183 10076507 117 tatcaatacatgaatgatttgtatgtggaatctgacttagaaatagggcagcataggacgagaatagaggaactgagagaacattttttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001184 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaggaatagaggagctgagaggacatctgttaaggtggggattttacacaccatacaag
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Serum Pol (RT) B (#) # AB001185 10076507 117 tgtcaatacatggatgatttgtatgtaggatctaacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001186 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagattgagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001187 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001188 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001189 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001190 10076507 105 ctggaaaagaaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001191 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgagaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001192 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactaaatggagaaacttagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001193 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001194 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001195 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001196 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgcaataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001197 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaaaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001198 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtacttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001199 10076507 105 tgggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacactactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001200 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001201 10076507 105 tgggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001202 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001203 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtattcgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001204 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001205 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001206 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001207 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctattaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001208 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001209 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaattagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001210 10076507 117 tatcaatacatggatgatttgtatgtaggatctggcttagaaatagggcagcatagaacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001211 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaattagaggaactgagagaacatctgttacggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001212 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaattagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001213 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001214 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001215 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatacctgttaaggtggggattttacacaccagacaag
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001216 10076507 117 tatcaatacatggatgatttgtatgtaagatctgacttagaaatagggcagcataggacaaaaatagaggaactgaaagaatatccgttaaggcggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001217 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001218 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001219 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaaccgagagaatatctattaaggtggggattttacacaccagacaac
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001220 10076507 117 tatcaaaacatagatgatatgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggatctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001221 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001222 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctattaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001223 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001224 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcaacataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Spleen Pol (RT) B (#) # AB001225 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001226 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001227 10076507 105 atggaaaaggaaggaaaaatttcaagaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001228 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001229 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001230 10076507 105 ttggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001231 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001232 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagaggacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001233 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatggagcagaaatagaggagctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001234 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcaacataggacgaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001235 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacgaaaatagaggagctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001236 10076507 117 tatcaagacatggatgatttgtatgtaggatctgacttagaaatagggcatcataggacaaaaatagagggactgagagaacatctgttgaggtggggagtttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001237 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001238 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaagatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001239 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001240 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttacggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001241 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaataggggagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001242 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggatctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) CSF Pol (RT) B (#) # AB001243 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggagctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001244 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001245 10076507 105 atgaaaaaggaaggaaaaatttcaaaaattgggcctaaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001246 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001247 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001248 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001249 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaactggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001250 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001251 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaagtccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001252 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001253 10076507 105 atgaaaaaggaaggaaaaatttcaaaaattgggcctaaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001254 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001255 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001256 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001257 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001258 10076507 105 atggaaaaggaaggaaaaatttcaagaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001259 10076507 105 ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001260 10076507 105 atgaaaaaggaaggaaaaatttcaaaaattgggcctaaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001261 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001262 10076507 105 atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001263 10076507 105 atgaaaaaggaaggaaaaattccaaaaattgggcctaaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001264 10076507 117 tatcaatacatggatgatttgtatgttggatctgacttagaaatagggcagcataggacaaaaatcgaggaactgagagaacatctgttatggtggggatttaccacaccagccaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001265 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001266 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001267 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001268 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001269 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001270 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001271 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagataaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001272 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagataaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001273 10076507 117 tatcaatacatggatgatttgtatgtaggatctaacttagaaacagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001274 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001275 10076507 117 tatcaagacatggatgatttgtatgtaggatctgacttagagatagggcagcataggacacaaatagaggggctgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001276 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001277 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001278 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggagctgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001279 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001280 10076507 117 tatcaatacatggatgatttgtatgtaggatctaacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001281 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001282 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaataggccagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagataaa
SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 AIDS 1993 Japan (unknown) Brain Pol (RT) B (#) # AB001283 10076507 117 tatcaatacatggatgatttgtatgtaggatctaacttagaaataggtcagcataggacaaaaatagatgaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006211 10076507 105 ttggaaaaggaagggaaaatttcacaaattgggcctgataatccatacaatactccagtatttggcataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006212 10076507 105 ttggaaaaggaagggaaaatttcacaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaagacagtactaatggagcaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006213 10076507 105 ttggagaaagaagggaacatttcacaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006214 10076507 105 ttggaaaaggaagggaacatttcacaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaagacagtactaaatggagaaaattagca
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006215 10076507 105 ttggaaaaggaagggaaaatttcacaaattggacctgaaaatccatacaatactccagtatttggaataaagaaaaaagacaggactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006216 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggaggaagttagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006217 10076507 105 ttggaaaaggaatggaacatgtcacaaattgggcctgataatccttacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006218 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgataatccatacaatactccagtatttgccataaggaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006219 10076507 105 ttggaaaaggaatggaacatctcacaaattgggcctgataatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006220 10076507 105 ttggaaaaggaatggaacatgtcacaaattgggcctgataatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006221 10076507 105 ttggaaaaggaatggaaaatgtcaaaaattgggcctgataatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006222 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagagcagcatagaataaaaatagaggaactgagacaacatctgtggaaatggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006223 10076507 117 tatcaatatttggatgatttgtatgtaggatttgacttagagatagttcaccataggatctgtatagaggaactgagacaacatctgtggaggtggggattttccacaccaggcaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006224 10076507 117 tatcaatacatggatgatttgtatgtaggatctgactcagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtcgaagtgggggttttgcacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006225 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagggcagcatagaataaaaatagaggaactgagacaacatctgtcgaagtgaggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006226 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaatagaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006227 10076507 117 tatcagtacatggatgatttgtatgtaggatctgacttagagatagaacaacatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006228 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaatcgagacaacatctgtggaggtggggattttccacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006229 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggatttaacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006230 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaaccgagacaacatctgtggaggtggggattttccacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006231 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaatcgagactacatctgtggaggtggggattttccacacctgacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006232 10076507 117 tatcagtacatggatgatttgtatgtaggatctgacttagagatggaacagcatagaagaaaaatagaggaatcgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006233 10076507 105 ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006234 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006235 10076507 105 ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006236 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcccgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006237 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006238 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttggcgtaaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006239 10076507 105 ttagaaaaggaagggaaaatttcacaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006240 10076507 105 ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006241 10076507 105 ttggaaaaggaagggagaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006242 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006243 10076507 105 ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006244 10076507 105 ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006245 10076507 105 ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006246 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatctgccataaagagaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006247 10076507 105 ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006248 10076507 105 ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006249 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006250 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB006251 10076507 105 ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006252 10076507 105 ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagataaaagacagtactaaatggagaaaattagta
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006253 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006254 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagagcatcatagaataaagatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006255 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacatagagatagaccagcatagagtcaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006256 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaccagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006257 10076507 117 tatcaatatatggatgatttgtatgtaggatctgacttagagatagtccagcatagaatcaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006258 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagtccagcatagaataaaaatagaggaactgagacaacatctgcggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006259 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagggcagcatagagtggagatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006260 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagataggacagcatagaataagaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006261 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006262 10076507 117 tatcaatacatggatgattcgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006263 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006264 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006265 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006266 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006267 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006268 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006269 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006270 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006271 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB006272 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006273 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006274 10076507 105 ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006275 10076507 105 ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006276 10076507 105 ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006277 10076507 105 ctggaaaaggacggtaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006278 10076507 105 ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattaata
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006279 10076507 105 ctggaaaaagatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattaata
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006280 10076507 105 ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006281 10076507 105 ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006282 10076507 105 ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006283 10076507 105 ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006284 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006285 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006286 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggatctaccacaccagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006287 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006288 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006289 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaataggacaacatagaacaaaaatagaggaactgggacaacatctgttgaggtggggatttaccacaccagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006290 10076507 117 tatcgatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaaatagaggaactgagacaacatctgttgaggtggggatttaccacaccagacaga
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006291 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006292 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006293 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctatggaagtggggattttacacaccagacaga
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Spleen Pol (RT) B (#) # AB006294 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggatttaacacaccagacaga
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006295 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaacaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006296 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006297 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgatagatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006298 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006299 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006300 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006301 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006302 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006303 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006304 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006305 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaaggacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006306 10076507 105 ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006307 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006308 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006309 10076507 117 tatcaatacatggatgatttgtatgtaggctctgatttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006310 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006311 10076507 117 tatcaatacatggatgatttgtatgtaggctctgatttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006312 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006313 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006314 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006315 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006316 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006317 10076507 117 tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1 No HAND M Unknown Risk Factor Unknown Viral Load 4 cells / ul AZT + ddI 33 33 AIDS 1999 Japan (unknown) Brain Pol (RT) B (#) # AB006318 10076507 117 tatcaatacatggatgatctgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007230 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007231 10076507 105 ttggaaaaggaagggaaaatttctaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaagttagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007232 10076507 105 atggaaaaggaagggaaaatttcaaaaattggacctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaagttagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007233 10076507 105 atggaaaaggaagggaaaatctcaaaaattgggcctgagaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007234 10076507 105 atggaaaaggaacaaaaaatttctaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007235 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaggttagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007236 10076507 105 atggaaaaggaagaaaaaatttctaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtattaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007237 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007238 10076507 105 atggaaaaggaacgaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaagttagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007239 10076507 105 atggaaaaggaagggaaaatttcaaaaattggacctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007240 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaagttagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007241 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007242 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007243 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccacacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007244 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007245 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgagaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007246 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacagtactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007247 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007248 10076507 105 atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007249 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctattgaagtggggattcaacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007250 10076507 117 tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctattgaagtggggattcaacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007251 10076507 117 tatcaatacatagatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctattgaagtggggattcaacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Unknown Tissue Pol (RT) B (#) # AB007252 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggtagcatagaacaaagatagaggaactgagacaacatctattgaagtggggattcaacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007253 10076507 117 tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007254 10076507 117 tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacgaaaatagaggaactgagacaacacctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007255 10076507 117 tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Unknown Tissue Pol (RT) B (#) # AB007256 10076507 117 tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcattgaacaaaaatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Unknown Tissue Pol (RT) B (#) # AB007257 10076507 117 tatcaatacatggatgatttgtatgttggatctgatttagaaatagggtagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007258 10076507 117 tatcaatacatggatgatttgtatgttggatctgatttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctagtgaagtggggattcaacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Spleen Pol (RT) B (#) # AB007259 10076507 117 tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007260 10076507 117 tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007261 10076507 117 tatcgttacgaggattatttgtatgttggatgtgatttagaaatagggcagaataggacaaatatagaggaattgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007262 10076507 117 tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007263 10076507 117 tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007264 10076507 117 tatagttacgaggatgatttgtatgtaggatcagatttagaaatagggcagcataggacaaatatagaggaattgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007265 10076507 117 tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007266 10076507 117 tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2 No HAND M Unknown Risk Factor Unknown Viral Load 1 cell / ul AZT 12 26 AIDS 1996 Japan (unknown) Brain Pol (RT) B (#) # AB007267 10076507 117 tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007268 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactataggaccaaggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007269 10076507 105 tgtacaagacctaacaacaatacaagaaaaaagataactataggaccagagaaagtattttatacaacaggacaaataataagagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007270 10076507 105 tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007271 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactataggaccaaggaaagtattttatacaacaggacaaataataggagatataaaaaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007272 10076507 105 tgtacaagacccaacaacaatacaaaaaaagggataactataaaaccaggaaaagtattttatacaacaggacaaataataagagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007273 10076507 105 tgtacaagacccaacaacaatacaaaaaaagagataactataaaaccaaggaaagtattttatacaacaggacaaataataggagatataagacaaacacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007274 10076507 105 tgtacaaaacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007275 10076507 105 tgtataagacttaataacaatacaagaaaagggataactatgggactagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007276 10076507 105 tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007277 10076507 105 tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcatattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007278 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggagagtattttatacaacaggacaaataataggaaatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007279 10076507 105 tgtacaagacccaacaacaatacaagaaaagggataactataggaccaaggaaagtattttacacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007280 10076507 105 tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggagaaataataggagatataagaaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007281 10076507 105 tgtacaaaacccaacaacaatacaagaaaaaggataactatggaaccaaggaaagtattttatacaacaggacaaataataggagatataaaacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Spleen Tat (gp160) B (#) # AB007282 10076507 105 tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007283 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataaggaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007284 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007285 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007286 10076507 105 tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007287 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007288 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactataggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007289 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007290 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007291 10076507 105 tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3 HIVE M Unknown Risk Factor Unknown Viral Load 2 cells / ul AZT 36 19 AIDS 1996 Japan (unknown) Brain Tat (gp160) B (#) # AB007292 10076507 105 tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
144 HAND Unknown Sex Unknown Risk Factor Unknown Viral Load Unknown CD4 Count Unknown Therapy Status Unknown Therapy Status Unknown Patient Age Unknown Patient Health Unknown Year Unknown Region Brain Tat (gp160) B (#) # AF125830 10381169 1042 accccactctgtgttactttaaattgcactgattggaagaatagtactaataccaatagtagtagtaataccataagagagatagagaaaggagaaataaaaaactgctctttcaatattaccacaagcataagagataaggtaaagaaagaatatgcacttttttatagacctgatgtagtaccaatagataatgataatactagttataggttgataaattgtaacacctcaaccattacacaagcctgtccaaaagtatcctttgagccaattcctatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaaattcagtggaaaaggaacatgtaaacctgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagcctagcagaagaagaggtagtaattagatctgacaatttcacgaacaatgttaaaaccataatagtacagctgaaagaagctgtagaaattaattgtacaagacccagcaacaatacaagaagaagtataaatataggaccagggagagcattttatacaacggaacaaataacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatagcaatttacaacagatagttaaaaaattaaaagaacaatttaggaatgcaacaacaatagtctttaatcaatcctcaggaggggacccagaaattgtaacacacagttttaattgtggaggggaatttttctactgtaacacatcaaaactgtttaatagtacttggattggaaatgatactaataacactgaagaaaatagcacactccctatcacactcccatgcagaataagacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacgaattagttgctcatcaaatattacagggctgctattgacaagagatggtggtactaacacaaataggactgagaccttcagacttggaggag
222 HAND Unknown Sex Unknown Risk Factor Unknown Viral Load Unknown CD4 Count Unknown Therapy Status Unknown Therapy Status Unknown Patient Age Unknown Patient Health Unknown Year Unknown Region Brain Tat (gp160) B (#) # AF125871 10381169 1023 accccactctgtgttactttaaattgcactgatttgaaaaataagactattgccaataatgatacagagatagaaatgaaaaactgctctttcaagatcacctcaaacatgagagataaaatgcatacggaatatgcacttttttataaacttgatatagtacaaatagataatgataatactagctataggttaataagttgtaacacctcagtcattacacaggcttgtccaaaggtatcctttgaaccaattcccatacattattgtaccccgcctggttttgcacttctaaagtgtaaggataagaagttcaatggaacaggaccatgtaaaaatgttagcacagtacaatgtacacatggaattaagccagtagtgtcaactcaactgctattaaatggcagtctagcagaagaagaggtaataattagatctaagaattttagtaataatgctaataacataatagtacagctaaatgaatctgtagcaattaattgtacaagacctaacaacaatacaagaaaaagtatacatatggtaccaggaaaagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacctcagtgaaacagactggaataaaaccttaaaacatgtagccgaaaaattaagagaacaatttaaagcaacacgaatagtctttgatcaatcctcaggaggggacccagaaattgtaatgcacagttttaattgtggaggggaatttttctactgtaatacaacacccctgtttaatagtacttggagtagtaatagtactatttcaaatgggactggaaagtcaaataatatcacactccaatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtacgcccctcccatcaaaggacaaattagatgttcatcaaatattacagggctgctattaacaagagatggtggtaataacagaaatgggactgaggtcttcagacttggaggagaagct
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174692 10482626 206 aaagagtttttagagctgttatccatatacctagacggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggaggcgatggcctgctgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgagacct
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174693 10482626 226 aaagagcttttagagctgttatcctcatacctaggcgaataagacagggctttgaaagggctttgctagaagatgggtggtaagtggtcaaaaagcagtaggatgggatggcctgcggtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgggacctggaaagacatggagcaatcacaagtagcaata
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174694 10482626 226 aaagagcttttagagctgttatcctcatccctaggcgaataagacagggctttgaaagggctttgctagaagatgggtggtaagtggtcaaaaagcagtaggatgggatggcctgcggtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgggacctggaaagacatggagcaatcacaagtagcaata
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174695 10482626 238 aaagagtttttagagctgttatccatatacctagacggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggatgggatggcctgctgtaagggaaagaatgagacgagctgagccagcagctgagccagcagcagatggggtgggagcagcatctcgagacctggaaagacatggagcaatcacaagtagcaata
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174696 10482626 205 aaagagtttttagagctgttatccatatacctaggcggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggacgggatggcctgctgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgagacc
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174697 10482626 226 aaagagcttttagagctgttatcctcatccctaggcgaataagacagggctttgaaagggctttgctagaagatgggtggtaagtggtcaaaaagcagtaggatgggatggcctgcggtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgggacctggaaagacatggagcaatcacaagtagcaata
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174698 10482626 238 aaagagtttttagagctgttatccatatacctagacggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggacgggatggcctgctgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatgggatgggagcagcatctcgagacctagaaagacatggagcaatcacaagtagcaata
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174699 10482626 226 aaagagcttttagagctgttatcctcatccctaggcgaataagacagggctttgaaagggctttgctagaagatgggtggtaagtggtcaaaaagcagtaggatgggatggcctgcggtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgggacctggaaagacatggagcaatcacaagtagcaata
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Nef (gp160) B (#) # AF174700 10482626 219 aaagagcttttagagctgttatccacatacctaggcgaataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggagtggatgggatactgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgagacctggaaagacatgga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Nef (gp160) B (#) # AF174701 10482626 238 aaagagcttttagggctgttatccacatacctaggcgaataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggagtggatgggatactgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagctggggtgggagcagcatctcgagacctggaaagacatggagcaatcacaagtagcaata
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174702 10482626 238 aaagagcttttagggctgttatccacatacctaggagaataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggagtggatgggaaactgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagctggggtgggagcagcatctcgagacctagagagacatggagcaatcacaagtagcaata
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Nef (gp160) B (#) # AF174703 10482626 238 aaagaggttttagagctgttatccatatacctagacggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggacgggatggtctgctgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgagacctagaaggacatggagcaatcacaagtagcaata
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174704 10482626 269 ccccactctgtgttactttaaagtgtaaagatgtggggaatactactaatatcactagtagcagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataaaagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174705 10482626 269 ccccactctgtgttactttaaagtgtgatgatgtgaggaataaaactaatatcactattagcagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagagataaggtgcagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatgataatactagctataggttgttaagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174706 10482626 263 ccccactctgtgttactttaaggtgtactgatgtgaggaataatactaataccactagtaatagctgggaaaagatggaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174707 10482626 263 ccccactctgtgttactttaaggtgtactgatgtgaggaataatactaataccactagtaatagctgggaaaagatggaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174708 10482626 269 ccccactctgtgttacgttaaggtgtactgatgtgaggaataatactaacaccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagaaagaacatgcacttttttataaccttgatgtagtaccaatagataatgataatgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174709 10482626 269 ccccactctgtgttacgttaaggtgtactgatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagaaagaacatgcacttttttataaccttgatgtagtaccaatagataatgataatgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174710 10482626 263 ccccactctgtgttactttaaagtgtactaatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagcaagaacatgcacttttttataaacttgatgtagtaccaatagataataataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174711 10482626 263 ccccactctgtgttactttaaagtgtactgatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagcaagaacatgcacttttttataaacttgatgtagtaccaatagataataataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174712 10482626 263 ccccactctgtgttactttaaagtgtactgatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagcaagaacatgcacttttttataaacttgatgtagtaccaatagataataataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174713 10482626 263 ccccactctgtgttactttaaagtgtactgatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagcaagaacatgcacttttttataaacttgatgtagtaccaatagataataataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174714 10482626 170 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtcc
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174715 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccagaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174716 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccagaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174717 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174718 10482626 164 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggc
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174719 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataaggctagctataggttgataagttgtaacacttcagttattacacaggcctgtccaaaggn
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174720 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccagaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174721 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174722 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174723 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174724 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgaagtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174725 10482626 182 gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaacagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174726 10482626 182 gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaatatgcacttttttataaacttgatgtagtaccaacagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggccagtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174727 10482626 182 gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaatatgcacttttttataaacttgatgtagtaccaacagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174728 10482626 181 gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcatacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174729 10482626 182 gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174730 10482626 182 gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174731 10482626 182 gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174732 10482626 182 gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174733 10482626 182 gagaaaggaggaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgatgatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174734 10482626 182 gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaacagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174735 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174736 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174737 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174738 10482626 162 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcaataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattaataagttgtaacacctcagtcattacacag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174739 10482626 163 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacagg
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174740 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174741 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174742 10482626 176 gaaaaaggagaaataaaaaattgctctttcgatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtatcaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174743 10482626 176 gagaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcaataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattaataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174744 10482626 176 gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattaataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174745 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaggacagcactaaatggagaaaattagtagatttcagagaacttaataagaggactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccaggaattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaattgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174746 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagtagatttcagagaacttaataagaggactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccaggaattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaattgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174747 10482626 585 aaaaaataaaagcattagtagaaatktgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagaggactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccattcctagtgtaaacaatgagacaccaggaattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttaggaaagaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgacttagaaataggacagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174748 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgacttagaaataggacagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174749 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174750 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174751 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Pol (RT) B (B) (No) AF174752 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatgaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174753 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174754 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagtagatttcagagaacttaataagaggactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccaggaattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaattgagacagcatctgttgaggtggggatttaccacaccagacaaaaaatatcagaaan
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Pol (RT) B (B) (No) AF174755 10482626 585 aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174756 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacatctgaataaatctgtagcaatccattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggggacataataggagatataagacaagcacattgtaacattagtagggcagactggaataacactttaaaacaggtagctataaagttaagaaaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174757 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtgtacatataacaccaggcagagcattttatgcaacaggagacattataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174758 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174759 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgaataaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcgcagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcaaaatgggagaacactttaaaacaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174760 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgaataaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcgcagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcaaaatgggagaacactttaaagcaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174761 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgaataaatctgtagcaattaattgtataagacccaacaacaatacaagaaaaggtatacatatagcaccaggcgcagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagtaaaatgggagaacactttaaaacaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174762 10482626 243 gtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174763 10482626 243 gtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaactgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174764 10482626 241 aattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagacataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagacaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174765 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174766 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtgcagcattttatacaacaggagacataataggagatataagacaagcacattataaccttagtaaagcagaatgggagaacactttaaaacaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174767 10482626 235 atctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174768 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcactctatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174769 10482626 243 gtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgactaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagagaacaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174770 10482626 243 gtaattaggtctgaaaatttctcagacaatgctaaaactataatagtacatctgaatraatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatrggaccagggagagcattgtatacaacaggacaaataataggaaatataagacaagcacattgtaacattagtagagaaaaatggaataaaactttagaacagatagttataaaattaggagaaaaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174771 10482626 241 aattagatctgaaaatttctcagacaatactaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccagggagagcattttatacaacaggacaaataataggaaatataagacaagcacattgtaacattagtagagaaagatggaataaaactttagaacagatagttaaaaaattaggagaaaaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174772 10482626 236 ggtctgaaaatttctcgaacaatgctaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaacgtttaggacagatagctataaaattaagagaaaaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174773 10482626 243 gtaattagatctgaaaatttctcgaacaatgctaaaactataatagtacatctgaatgaatctgtagaaattaattgtataagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagatagctataaaattaagagaaaaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174774 10482626 237 agatctgaaaatttctcgaacaatgttaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagctagctataaaattaagagaaaaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174775 10482626 243 gtaattagatctgaaaatttctcgaacaatgttaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagatagctataaaattaagagaaaaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174776 10482626 243 gtaattagatctgaaaatttctcgaacaatgttaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagatagctataaaattaagagaaaaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174777 10482626 243 gtaattagatctgaaaatttctcgaacaatgctaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagatagctataaaattaagagaaaaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 Unknown Patient Health 1999 United Kingdom (unknown) Spleen Tat (gp160) B (#) # AF174778 10482626 234 tctgaaaatttctcggacaatgctaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaacgtataactatgggaccagggagagtatattatacaacaggacaaataataggaaatataagacaagcacattgtaacattagtagagaaagatggaataaaactttagaacagatagttataaaattaggagaaaaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174779 10482626 243 gtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaayaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174780 10482626 243 gtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatcgaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174781 10482626 243 gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtagaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174782 10482626 243 gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagayataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174783 10482626 230 aaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174784 10482626 230 aaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174785 10482626 231 gaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174786 10482626 231 gaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagaacaaratggaataaaactttaaaacagatagttatcaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174787 10482626 231 gaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174788 10482626 231 gaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174789 10482626 242 taattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174790 10482626 242 taattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174791 10482626 243 gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaagrcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaa
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174792 10482626 207 gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataac
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174793 10482626 243 gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaagrcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174794 10482626 243 gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaggwatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174795 10482626 243 gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctrtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagagcattttatacaacaggagaaataataggaaatataagacaagcacattgtaaccttagtagaacagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174796 10482626 243 gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaggaatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174797 10482626 243 gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctatagaaattaattgtacaagacccaacaacaatacaaggaaaggtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174798 10482626 243 gtaattagatccgccaatttcacaaacaatgctaaagtcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattctatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtggagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174799 10482626 243 gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174800 10482626 243 gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccaggcagagcattctatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtagagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174801 10482626 243 gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtagagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174802 10482626 243 gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctaaataaatctgtagaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatcgaacaggagaaataataggaaatataagacaagcacattgtgaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174803 10482626 243 gtaattagatcagccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctatagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatcgaacaggagaaataataggaaatataagacaagcacattgtaaccttagtggaacagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174804 10482626 264 ctagcagaagaagaggtagtaattagatctgaaaatttctcaaacaatgctaaaaccgtaatagtacagctgactaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactctaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174805 10482626 264 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgctaaaatcataatagtacatctgaataaatctatagcaattaattgtacaagacccaacagcaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggcgatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaaaacaggtagctatgaagttaagagaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174806 10482626 264 ctagcagaagaagggatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaataaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagaacagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174807 10482626 264 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgactaaacctgtagcaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgcaaccttagtagagcagcctggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174808 10482626 264 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgctataaccataatagtacagctgactgaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtagccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174809 10482626 264 ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagacataagacaagcacattgtaaccttagcagaacagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174810 10482626 264 ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacatctgaataaatctgtagcaatccattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggggacataataggagatataagacaagcacattgtaacattagtagggcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174811 10482626 273 ctagcagaagaagaggtagtaattagatctgaaaatttctcaaaatttctcaacaacgctaaaaccataatagtacagctgactaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174812 10482626 264 ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtgtacatataacaccaggcagagcattttatgcaacaggagacattataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174813 10482626 264 ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagacataagacaagcacattgtaaccttagcagaacagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174814 10482626 264 ctagcagaagaagaggtagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacatctgaataaatctgtagcaatccattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggggacataataggagatataagacaagcacattgtaacattagtagggcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF174815 10482626 264 ctagcagaagaagaggtagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgactaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggtagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174816 10482626 266 ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174817 10482626 266 ctagcagaagaagacatagtaattagatctgcaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174818 10482626 266 ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgttagaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttaagacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174819 10482626 266 ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174820 10482626 266 ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174821 10482626 266 ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagctattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttaagacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174822 10482626 266 ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggggacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174823 10482626 266 ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaactatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174824 10482626 266 ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaactgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174825 10482626 266 ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174826 10482626 266 ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174827 10482626 266 ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174828 10482626 266 ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtagagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174829 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagtaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagacgaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174830 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagtaccaggcacagcattttatacaacaggagacataataggagacataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174831 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174832 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174833 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174834 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174835 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174836 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaataatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174837 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcatttcatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagaggacaatatca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174838 10482626 266 ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatatgagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174839 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174840 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagactactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174841 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF174842 10482626 266 ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174843 10482626 400 agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggccgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataagggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174844 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcaggaaaaagcacagcaagcacagcgagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174845 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctagcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagcagataaaggaagagcaaaacaaaaataagataaaagtacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174846 10482626 400 agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagatacccaggaagctttagagcagataaaggaagagcaaaacaaaagtaagataaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174847 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagatagaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174848 10482626 400 agggggaaagaaaagatataaattaaagcatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtacagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174849 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcacggcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174850 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacaccaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174851 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagacagaggaagagcaaaacaaaagcaagaagaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174852 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagataggatcagaagaacttagatcattatttaatacagtagcgaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctctagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174853 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagtacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctaaaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174854 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174855 10482626 381 tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatgcaatagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacaacgagcagcagctgccacaggaaacagcagccaggtcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174856 10482626 381 tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcaggcaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174857 10482626 382 tatcaattaaaacatatagtatgggcaagcaaggaactagaacgattcgcagttaatcctggcctattagaaacagcagaaggctgtagacaaataatagaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaagtcagccaggtcagccaaaattaccctatagtgcagaacctacaagggcaaatggtacatcaggccatatcacctagaactttaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174858 10482626 381 tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaasarkaragcaswscaagcagcarsagacgcaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174859 10482626 381 tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174860 10482626 381 tataaattaaagcatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatactagaacagctacaatcatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaagaatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaacctacaggggcaaatggtacatcaggccatatcacctagaacttta
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174861 10482626 381 tatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacagcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaaaatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaaccttcaagggcaaatggtacatcaggccatatcacctagaactttaaat
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174862 10482626 382 tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaactttaa
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174863 10482626 372 tataaattaaaacatatagcatgggcaagcatagaacaagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaggacaccaaggaagctttagataaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagctgacacaggaaacagcagccaagtcaaccaggtcagccaaaattaccctatagtgcagaacctacaagggcaaatggtacatcaggccatatcacctaga
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174864 10482626 381 tataaactaaaacatatagtatgggcaagcatagagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaagagctacaaccatcccttcaggcaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaargcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaacctacaggggcaaatggtacatcaggccatatcacctagaacttta
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174865 10482626 381 tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatactagaacagctacaatcatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaaaatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaacctacaggggcaaatggtacatcaggccatatcacctagaacttta
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174866 10482626 375 tataaattaaaacatatagcatgggtaaaagtagtagaagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattaggacaactacaatcatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaacctacaggggcaaatggtacatcaggccatatcacctaga
NA173 HIVE M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count ZDV 5 34 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174867 10482626 381 tataaattaaaacatatagtatgggcaacaatagaacaagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaargatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174868 10482626 414 gggggaaagaaaaaatatcaattaaaacatatagtatgggyaagcrmggtgttagaaaaattcgcaattaatcctggcctgttagaaacatcagaaggttgtagacaaatactgggacagctacaaccagcccttcagacaggatcagaaggacttaaatcattatataatacagtagcaaccctctattgtgtgcatcgaatgatagaggtaaaagacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagaagctggcacaggacacagcagccaggccgcagctrgcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174869 10482626 414 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcrgggwgttagaakrattcgcartyaatcctggcctgttagaaacatcagaaggytgtagacaaataytgggacagctacaaccagcccttcagacaggatcagaaggacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaggacaccaaggaagctctagycaagatagaggaagagcaaaagaaaagtaagaaaaaggcacagcaagcagcagctggcacaggacacagcagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174870 10482626 396 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaatattrgaacagctacaaccatcccttaggacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacaaccaggccgcagctagcacaggaaacagcagccagatcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcag
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174871 10482626 414 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcrgggwgctagaakrattcgcaatyaaccctggtctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccamcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174872 10482626 413 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggwgctagaakrattcgcartyaatcctggcctmttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaac
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174873 10482626 415 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaakrattcgcartyaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccamcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactt
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174874 10482626 415 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtyaaccctggtctgttagaaacatcagaaggctgcagacaaatactggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctrgcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactt
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174875 10482626 413 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaatattgggacagctacaaccatcccttkagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaagagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaac
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174876 10482626 414 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcacaggaaacagcagccaggtcagccaaaattaccctatagtgcgraacctacagggacaaatggtacatcaggccatatcacctagaact
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174877 10482626 414 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaataytggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacagggacaaatggtacatcaggccatatcacctagaact
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174878 10482626 414 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggtgctagaacgattcgcagtyaatcctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcarccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174879 10482626 414 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaracatcagaaggctgcagacaaatattggaacagctacaaccamcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174880 10482626 397 gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaaccaskrgcaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcagg
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174881 10482626 396 gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcwttatttaatacagtagcaaccctctattgtgtgcatcaagggatagtggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcag
UK1_NA21 HIVE F IV Drug User Unknown Viral Load 87 cells / ul ZDV + ddC 12 49 Deceased 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174882 10482626 412 gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcwttatttaatacagtggcaaccctctattgtgtgcrtcgagggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaa
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174883 10482626 367 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcaatcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagacagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatcacctaga
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174884 10482626 370 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtacatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagccagcaacagcagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174885 10482626 361 atataaattaaaacatatagtatgggcaagcagggagytagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatca
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174886 10482626 367 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatattagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagccagcagcagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174887 10482626 361 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174888 10482626 361 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174889 10482626 373 atataaattaaaacatataatatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagagacatcagaaggctgtagacaaatattagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagccagcacgagcaacggcagcagctgccacaagaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174890 10482626 361 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagataccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatca
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174891 10482626 361 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgaatagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacaaccagcagcagctgccacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatca
NA128 HIVE M Unknown Risk Factor Unknown Viral Load 4 cells / ul ZDV + ddC 18 48 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174892 10482626 361 atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctagcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatgcagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Spleen Gag (p17) B (B) (No) AF174893 10482626 372 atatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtacatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaatcaaaagtaagaaaaaagcacagccagcagcagcagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacagcaggccatatcacc
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174894 10482626 400 agggggaaagaaaagatataaattaaagcatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtacagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174895 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174896 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcaggaggctatagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174897 10482626 399 gggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174898 10482626 399 gggggaaagaaaagatataaattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaggtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174899 10482626 399 gggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174900 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagnaagcagcagctggcacaggaaacagcagccaggccaaccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174901 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcgaaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174902 10482626 400 agggggaaagaaaagatataaattaaagcatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcaccgaaagatagatgtaaaagacaccaatgaagctttagaaaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174903 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcgaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaggaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174904 10482626 400 agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggccgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataagggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174905 10482626 397 gggaaagaaaacatataaattaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174906 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggagcagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataagggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174907 10482626 397 gggaaagaaaacatataaattaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174908 10482626 397 gggaaaaaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174909 10482626 397 gggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattagagcagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatgcagtagcaactctctattgtgtgcatcaaaggataaaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctgacacaggaaacagcggtcaggccagccaaaattaccctgtagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174910 10482626 400 agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggccgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataagggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174911 10482626 394 aaagaaaacatataaactaaaacatatagtatgggcaagcagggaactagaacgattcgcagccaaccctggcctattagaaacatcagaaggctgtaaacaaatattggaacagctacaatcatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174912 10482626 394 aaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggagcagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaatgcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174913 10482626 397 gggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattagagcagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatgcagtagcaactctctattgtgtgcatcaaaggataaaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctgacacaggaaacagcggtcaggccagccaaaattaccctgtagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174914 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcacggcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174915 10482626 400 agggggaaagaaaggatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174916 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacggcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174917 10482626 397 gggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174918 10482626 397 gggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagagcgattcgcagttcatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174919 10482626 397 gggaaagaaaagatataaatcaaaacatatagtatgggcgagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174920 10482626 399 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174921 10482626 399 aggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174922 10482626 400 aggggggaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174923 10482626 399 agggggaaagaaaaggtataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccccctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174924 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcaggaaaaagcacagcaagcacagcgagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174925 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaagaacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174926 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatatgggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccagggacaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174927 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174928 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaagatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174929 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcaggaagaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174930 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaagcagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174931 10482626 400 agggggaaagaaaacatataaattaaaacatataatatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcaggaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174932 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174933 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagattaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174934 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctagcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagcagataaaggaagagcaaaacaaaaataagataaaagtacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174935 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacagccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagcagataaaggaagagcaaaacaaaaataagataaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174936 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagagagctagaacgatttgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaagaatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaaccttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174937 10482626 400 agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagatacccaggaagctttagagcagataaaggaagagcaaaacaaaagtaagataaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174938 10482626 400 agggggaaagaaaacatatacattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaagtcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaatagcggtcaggccagtcaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174939 10482626 400 agggggaaagaaaacatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagatacccaggaagctttagagcagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactctaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174940 10482626 389 aaacatatcaattaaaacatatagtatgggcaagcagggaactagaacgatttgcaattaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacggcaagcacagcaagcagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174941 10482626 388 aacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacaactacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaagaatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaagacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagtcaaaattaccctatagtacaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174942 10482626 387 aaaacatataaactaaaacatatagtatgggcaagcagggagctagaacggttcgcagttaaccctggcctgttggaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagagcttagatcattatgtaatgcagtagcaactctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacaagcagcagctggcacaggaaacagcggtcagaccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174943 10482626 400 agggggaaagaaaacatataaattaaaacatgtagtatgggcaagcagggaactagaacgatttgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaagcacagcaagcacagcaagcagcagctggcacaggaaatagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174944 10482626 400 agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggattgatgtaaaagacacccaggaagctttagagaagataaaggaagagcaagtcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaatagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174945 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcaattaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccctcagacagggtcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataggggaagagcaaagcaaaagtcggaaaaaagcacagcaagcacagcaagcagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174946 10482626 391 gaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagcagataaaggaagagcaaaacaaaaataagataaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccaaccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174947 10482626 389 aaacatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174948 10482626 390 aaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctattagaagcatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagtacagcaagcacagcaagcagcagctgacgcaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174949 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaaccctggtctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174950 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcggggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Lymph Node Gag (p17) B (B) (No) AF174951 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagagagctagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacggctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaagaatagatgtaaaagacacccaggaagctttagagaggataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaaacacagcaagtggcagctggcacaggaaacagtggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174952 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacaccaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174953 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174954 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174955 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagggcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccagaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174956 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagctatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174957 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcaggaagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccctcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174958 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174959 10482626 400 agggagaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174960 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174961 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174962 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagacagaggaagagcaaaacaaaagcaagaagaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174963 10482626 400 ggggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccaaccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174964 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174965 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174966 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaatcatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcagggacaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174967 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174968 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174969 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174970 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgcagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174971 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagacagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaagaaggcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggcctcatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174972 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagataggatcagaagaacttagatcattatttaatacagtagcgaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctctagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174973 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174974 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174975 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtaggcaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174976 10482626 386 gatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctantgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttgtcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174977 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatgcagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174978 10482626 399 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagctagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaa
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174979 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174980 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174981 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaggcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174982 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagtacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctaaaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174983 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgcagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcgcaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174984 10482626 386 gatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaagtattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtacaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcgcctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174985 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174986 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccgtcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccccctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacagaagtaagaaaaaagtacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174987 10482626 390 aaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174988 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccggccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174989 10482626 399 gggggaaagaaaagatataaattaaaacatatagtatgggcaagctgggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174990 10482626 400 agggggaaagcaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagtacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174991 10482626 400 agggggaaagcaaagatataaattaaaacatataatatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174992 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagatagaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174993 10482626 400 agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174994 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174995 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174996 10482626 394 aaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174997 10482626 391 gaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174998 10482626 390 aaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF174999 10482626 400 agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattagaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacggcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175000 10482626 400 agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175001 10482626 400 agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175002 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175003 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcagggacaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175004 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccccatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175005 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175006 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175007 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175008 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175009 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatcgagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175010 10482626 400 agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccccatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 AIDS 1999 United Kingdom (unknown) Brain Gag (p17) B (B) (No) AF175011 10482626 399 gggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175012 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatactgaaaggacaaatatcactgaaggaaatggtaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagttggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175013 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175014 10482626 236 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgataaacatgtggcaggaaataggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175015 10482626 252 tcaacacagctgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccctgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggcattaacacaagagacaacaagacagagatcttcggacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175016 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175017 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175018 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatactgaaaggacaaatatcactgaaggaaatggtaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175019 10482626 258 tcaacacgactgtttaatagtacttggaatggtactgaagggacaacaaatatcactgaaggaaatggtaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacgagacagaggtcttcagacctgtaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175020 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaaccaataacactggggaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175021 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgctcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175022 10482626 252 tcaacacaactgtttaatggtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaagaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175023 10482626 255 tcaacacaactgtttaatagtacttgggataggcctgaagggacaaatatcactgaaggaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175024 10482626 252 tcaacacaactgtttaatggtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175025 10482626 251 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatccccctcccatcagaggacaaattagatgttcatcaaatattacgggatgattttaacaagagatggtggtattaacacaagagacaagaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175026 10482626 249 tcaacacaactgtttaatagtacttgggatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaatgaaacaaattataaacatgtggcaggaagcaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtaataccacgaacgcgaccaccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175027 10482626 255 tcaacacaactgtttaatagtacttgggataggcctgaagggacaaatatcactgaaggaaatgacaatatcacactcccatacagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagagggcaaattagatgttcatcaaatattacaggtataatgttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175028 10482626 249 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtaataccacgaacgagaccaccgagatcttcggacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175029 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagctggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacgcaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175030 10482626 252 tcaacacaactgtttaatagtacttgggataatcctgaagggacaaatatcactgaaggaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacaggtataatgttggcaagagatggtggtaataccacgaacgcgaccaccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175031 10482626 249 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacaggtataatgttaacaagagatggtggtaataccacgaacgcgaccaccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175032 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactgcagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175033 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175034 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175035 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175036 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175037 10482626 251 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacagattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattgatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175038 10482626 252 tcaacacaactgtttaatagtacttggaatggtactaaagagacaacaaacaacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagacgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175039 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175040 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175041 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtgatattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175042 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175043 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175044 10482626 252 tcaacacaactgtttaatagtacttggaatggtgctgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtgatattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175045 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggaggt
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175046 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattatgaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175047 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtatcagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175048 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175049 10482626 251 caacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtgatattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175050 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175051 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175052 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgagggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagagatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175053 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175054 10482626 251 caacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggccttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175055 10482626 251 caacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcagaaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175056 10482626 252 tcaacacaactgtttaatagtacttggaatggtactaaagagacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175057 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactgcagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175058 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaacaacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175059 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF175060 10482626 252 tcaacacaactgtttaatagtacttgggataatccagaagtgttaaataacactgaaggaaatggcacaaccacactaccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagtcgttcatcaaatattacaggtataatgttaacaagagatggtggtaataccacgaacgagaccaccgagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF175061 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcagtgtatgcccctcccatcaggggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF175062 10482626 252 tcaacacaactgtttaatagtacttgggataatggtgaagtgttaagtaacactgaaggaaatggcacaaccacactaccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagttgttcatcaaatattacaggtataatgttaacaggagatggtggtaataccacgaacgagaccaccgagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF175063 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF175064 10482626 252 tcaacacagctgtttaatagtacttgggataatcctgaagggacaaatatcactgaaggaaatgacaatatcacacttccatgcagaataaaacaaattataaacatgtggctggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagttgttcatcaaatactacaggtataatgttaacaagagatggtggtaatagcacgaacgagaccaccgagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF175065 10482626 252 tcaacacaactgtttaatagtacttgggataatcctgaagggacaaatgtcactgaaggaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagttgttcatcaaatattacaggtataatgttaacaagagatggtggtaatagcacgaatgagaccaccgagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF175066 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcagtgtatgcccctcccatcaggggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF175067 10482626 255 tcaacacagctgtttaatagtacttgggataatcctgaagggacaaatatcactgaaggaaatgacaatatcacacttccatgcagaataaaacaaattataaacatgtggctggaagtaggaaaagcaatgtatgcccctcccatcaggggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Lymph Node Tat (gp160) B (#) # AF175068 10482626 250 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcagtgtatgcccctcccatcaggggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggaggtattaacacaagagacaacaagacagagatcttcagacctggaggag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175069 10482626 255 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgcatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175070 10482626 255 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatggggggattaacacaggcgacaacaagacagaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175071 10482626 255 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatggtgggattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175072 10482626 245 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagact
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175073 10482626 255 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175074 10482626 255 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175075 10482626 252 tcaacacaactgtttaatagtacttggaatgatactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacagattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175076 10482626 252 tcaacacaactgtttaatagtacttggaatgatactgaagggacgacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatctttagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175077 10482626 252 tcaacacaactgtttaatagtacttggaatgatactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggggga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175078 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcctctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175079 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175080 10482626 252 tcaacacaactgtttaatagtacttggaatgatactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagacggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175081 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175082 10482626 252 tcaacacaactgtttaatagtacttggaatgatactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175083 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaagcaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175084 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175085 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175086 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175087 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175088 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagcaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatttcaacaagagatggtggtattagcaagagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175089 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175090 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaagagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175091 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaagagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175092 10482626 261 tcaacacaactgtttaatagtacttgggatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175093 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175094 10482626 261 tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagcaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatttcaacaagagatggtggtattagcaagagcaacaacgattccgaggtcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175095 10482626 225 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaac
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175096 10482626 255 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175097 10482626 255 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175098 10482626 106 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaatagcactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaaca
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175099 10482626 205 ttaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggg
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175100 10482626 255 ttaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcgcactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175101 10482626 206 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacgaattagatgttcatcaaatattacagggatgatattaacaagagatggggg
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175102 10482626 255 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175103 10482626 218 tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgccccacccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175104 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggaggaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtttatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175105 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagggacaacaagacagagatcttcagacttggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175106 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacacttccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175107 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175108 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175109 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175110 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175111 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaagcaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtttatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175112 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaaggcagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175113 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175114 10482626 237 tcaacgcaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttagaggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175115 10482626 241 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175116 10482626 250 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175117 10482626 250 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcagcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaaggcagagatcttcagacctggaggag
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175118 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggaggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175119 10482626 252 tcaacacaactgtttaatagtacttggaatggtactgaagggacgacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175120 10482626 243 ctgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggacgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175121 10482626 230 tgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttacagggatgattttaacaagagatggtggtattaacacaagagacaaaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175122 10482626 231 tgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234 HIVE Unknown Sex IV Drug User Unknown Viral Load 30 cells / ul ZDV 1 28 Unknown Patient Health 1999 United Kingdom (unknown) Brain Tat (gp160) B (#) # AF175123 10482626 242 tgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcagcaaatattaccgggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Bone Marrow gp160 (Rev) B (B) (No) AF217150 10871768 2665 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttgacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgatactatggggaatgctactaataccaatagtactagccagaatgctactaataccaataatactagctgggaagagatggagaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatggaatcaggccagtagtatcaactcaactgctgttaaatggtagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaactataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagagcaaaatggaatgaaactttaaaacaggtagttgacaaattaggaaagcaatttaagaataaaacaaagatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaaggatgaaggtaaagagaacgataccgagaccttcagaccacaaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggacacgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacagatttaatatataacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttcacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagcaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Bone Marrow gp160 (Rev) B (B) (No) AF217151 10871768 2665 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgatactatggggaatgctactaataccaatagtactagccagaatgctactaataccaataatactagctgggaagagatggagaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatggaatcaggccagtagtatcaactcaactgctgttaaatggtagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaactataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagagcaaaatggaatgaaactttaaaacaggtagttgacaaattaggaaagcaatttaagaataaaacaaagatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaaggatgaaggtaaagagaacgataccgagaccttcagaccacaaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggacacgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacagatttaatatataacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttcacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Bone Marrow gp160 (Rev) B (B) (No) AF217152 10871768 2665 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagagaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgatactatggggaatgctactaataccaatagtactagccagaatgctactaataccaataatactagctgggaagagatggagaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttggtgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatggaatcaggccagtagtatcaactcaactgctgttaaatggtagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaactataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggaaagcattatatacaacaggagccataataggagatataagaaaagcgtattgtaacattagtagagcaaaatggaatgaaactttaaaacaggtagttgacaaattaggaaagcaatttaagaataaaacaaagatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaaggatgaaggtaaagagaacgataccgagaccttcagaccacaaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggacacgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacagatttaatatataacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttcacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatcccctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Choroid Plexus gp160 (Rev) B (#) * AF217153 10871768 2644 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctagaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtctattatgaggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttaggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaatgccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaataaataatgatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaggataagaacttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatagaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccaaggagagcattttatacaacaggagacataataagagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaggaataaaacaatacagtttcagccatcctcaggaagagacccagaaattgtaacacacagtctgaattgtggaggggaatttttctactgtaatacaacacacctgtttaatagtaattggactactattaatggtactacttggaatagtactgaaaggtcaaataacactgtaagaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccaggaggaggaaatatgaaggacaattagagaagtgaattatataaatataaagtagtacaaattgaaccattaagagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtaggaataggagctgtgttccttaggttcttaggagcagcaggaagcactataggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatctgctgaaggctattgaggcgcaacagcatctgttgcaactcacagtctaaggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctaggaatttgaggttgctctagaaagctcatctgcaccactactgtgccttagaatgctagttggagtaataaatccctagatatgatttagaataacatgacctggatggagtaggaaaaagaaattggcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattagataaatgggcaagtttgtagaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtagaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggagggaactaaagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataaggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaaaggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Choroid Plexus gp160 (Rev) B (#) * AF217154 10871768 2644 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctagaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtctattatgaggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttaggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaatgccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaataaataatgatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaggataagaacttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatagaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccaaggagagcattttatacaacaggagacataataagagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaggaataaaacaatacagtttcagccatcctcaggaagagacccagaaattgtaacacacagtctgaattgtggaggggaatttttctactgtaatacaacacacctgtttaatagtaattggactactattaatggtactacttggaatagtactgaaaggtcaaataacactgtaagaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccaggaggaggaaatatgaaggacaattagagaagtgaattatataaatataaagtagtacaaattgaaccattaagagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtaggaataggagctgtgttccttaggttcttaggagcagcaggaagcactataggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatctgctgaaggctattgaggcgcaacagcatctgttgcaactcacagtctaaggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctaggaatttgaggttgctctagaaagctcatctgcaccactactgtgccttagaatgctagttggagtaataaatccctagatatgatttagaataacatgacctggatggagtaggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattagataaatgggcaagtttgtagaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtagaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggagggaactaaagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataaggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaaaggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Choroid Plexus gp160 (Rev) B (B) (No) AF217155 10871768 2644 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctagaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtctattatgaggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttagaccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaatgccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaataaataatgatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaggataagaacttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatagaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccaaggagagcattttatacaacaggagacataataagagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaggaataaaacaatacagtttcagccatcctcaggaagagacccagaaattgtaacacacagtctgaattgtggaggggaatttttctactgtaatacaacacacctgtttaatagtaattggactactattaatggtactacttggaatagtactgaaaggtcaaataacactgtaagaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccaggaggaggaaatatgaaggacaattagagaagtgaattatataaatataaagtagtacaaattgaaccattaagagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtaggaataggagctgtgttccttaggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaacgatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggaatgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaactggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217156 10871768 2647 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcgttacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatgctcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaatcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcctgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217157 10871768 2647 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgcgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaagtcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217158 10871768 2647 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaggacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaatcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217159 10871768 2647 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccaccctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaatcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagagggaacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217160 10871768 2647 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatgtgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaatcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217161 10871768 2635 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagtttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctgttgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtagtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217162 10871768 2635 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagaacctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagtttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217163 10871768 2635 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagcttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggctcgaaggaatcgcagaagaaggtggagagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217164 10871768 2635 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccagcccacaagaagtagacttgaaaaatgtggcagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagtttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Brain gp160 (Rev) B (B) (No) AF217165 10871768 2634 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagtttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggggagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Lymph Node gp160 (Rev) B (B) (No) AF217166 10871768 2650 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagagttattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcaccgatgctaataccactagtactggcaagaatgttactaataccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacacacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataaggataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagacctcctttgaaccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaacttcaatggatcaggaccatgtgcaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccagggagagcattctatacaacaggagacataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaagaataaaacaaaaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtgggggggaatttttctattgtaattcaacaccactgtttaatagtaattggactactattaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacaataaccaaacaggtaacgataccaccgagaccttcagaccgggaggaggaaatatgagggataattggagaagtgaattatataagtataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagtgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttcacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacgggcccgaaggaatcgcagaagaaggtggagagagagacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Lymph Node gp160 (Rev) B (B) (No) AF217167 10871768 2617 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccctgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtatattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataattagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggagaggaatgctactaatatcactagtagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtacaaatagataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaaaaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaataatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggaaaacaatttaagaataaaacaaagatagcttttcagccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcagggagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgagatcttcagaccgggaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtgggacgatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatacgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacaattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Lymph Node gp160 (Rev) B (B) (No) AF217168 10871768 2614 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctacagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagactaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactagtagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtacaaatagataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctgaagtgtaaagataagaatttcaatggaaaaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcgactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaataatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggagaacaatttgggaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaattcttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcagggagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaggtgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgagatcttcagaccgggaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaggaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagctatcgcagtagctgaagggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Lymph Node gp160 (Rev) B (#) * AF217169 10871768 2614 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttaagatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtatattatggggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttaggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtaacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataattagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggagaggaatgctactaatatcactagtagtggcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagggataaggtacagaaagaatatgcacttttttataaacttgatgtagtacaaatagataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaaaaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaataatacaagaaaaggcatacatataggaccagggagagcattttatacaacagaagacataataggagacataagacaagcatattgtaaccttagtagaacacaatagaataaaactttagaacaggtagttataaaattaggagaacaatttaagaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgagaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcagggagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacaaggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgagatcttcagaccaggaggaggaaatatgaaggataattagagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtaggaataggagctgtgttccttaggttcttaagagcagcaggaagcactataggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagagctattgaggcgcaacagcatctgttgcaactcacagtctagggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctaggaatttaaggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctagatatgatttagaataacatgacctagatggagtaggaaaaagaaattagcaattacacaaatgtaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattggataaatgggcaagtttgtagaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaagaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaataaagttaggcagagatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagaccaggacgattagtagatggattcttagcacttatctaggacgacctgcggagcctgtgcctcttcagctaccaccgcttgaaagacttactcttgattgtaacgaggattgtggaacttctaggacgcagaaggtaagaaatcctcaaatattggtggaatctcctgcagtattgggggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgagaggacagataaggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaaaggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Lung gp160 (Rev) B (B) (No) AF217170 10871768 2614 taatagaaagagcagaagacagtggtaatgagagtgaaggagatcaggaagaactattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggagaggaatgctactaatatcactattagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtacaaatagataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaaaaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggagaacaatttgggaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggagggggatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcagggagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagagtaacaataccgaggtcttcagaccgggaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattgttgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctagatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatgtaatatacaacttaattgaagaatcgcagaaccaacaagaaaaaaatgaacatgaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaaccgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Lung gp160 (Rev) B (B) (No) AF217171 10871768 2650 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtatggaaagaagcaactaccaccctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtatgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaacaacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaatatcactagcactaccactcctagcactacccctagtactggctggggaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataatacaagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgaaccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatacaacaggagacataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaggtagttggaaaattaggagaacaatttaagaatacaacaaagatagcttttcagccatcctcaggaggggacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccactgtttaatagtaattggactaggaataataatacttggaataatactggagagtcaaatcacactgaagacacaatcagtctctcatgcaggataaaacaaattataaacagatggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggttactattaacaagagatggtggtaacaataacaataccggtaacaacaccgagaccttcagaccgggaggaggaaatatgaaggacaattggagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaagctcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccggccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataggattatagaactagtacaaagaatttatagagctattctccacatacctagaagaataagacagggtttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Lung gp160 (Rev) B (B) (No) AF217172 10871768 2650 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtatggaaagaagcaactaccaccctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtatgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaacaacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaatatcactagcactaccactcctagcactacccctagtactggctggggaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataatacaagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgaaccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatacaacaggagacataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaggtagttggaaaattaggagaacaatttaagaatacaacaaagatagcttttcagccatcctcaggaggggacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccactgtttaatagtaattggactaggaataataatacttggaataatactggagagtcaaatcacactgaagacacaatcagtctctcatgcaggataaaacaaattataaacagatggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggttactattaacaagagatggtggtaacaataacaataccggtaacaacaccgagaccttcagaccgggaggaggaaatatgaaggacaattggagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaagctcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaatcggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataggattatagaactagtacaaagaatttatagagctattctccacatacctagaagaataagacagggtttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Lung gp160 (Rev) B (B) (No) AF217173 10871768 2650 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtatggaaagaagcaactaccaccctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtatgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaacaacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaatatcactagcactaccactcctagcactacccctagtactggctggggaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataatacaagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgaaccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatacaacaggagacataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaggtagttggaaaattaggagaacaatttaagaatacaacaaagatagcttttcagccatcctcaggaggggacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccactgtttaatagtaattggactaggaataataatacttggaataatactggagagtcaaatcacactgaagacacaatcagtctctcatgcaggataaaacaaattataaacagatggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggttactattaacaagagatggtggtaacaataacaataccggtaacaacaccgagaccttcagaccgggaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccggccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaagggactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataggattatagaactagtacaaagaatttatagagctattctccacatacctagaagaataagacagggtttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Meninges gp160 (Rev) B (B) (No) AF217174 10871768 2526 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtatattatggggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtaacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataattagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgaagaggaatgctactaatactagtagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataagactagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggagaacaatttgggaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccggggggaggaaatatgaaggacaattggagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattgttgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattagataaatgggcaagtttgtagaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaagtattggtggaatctcctgcagtattgggggaaggaactaaagaatagtgctgttagcttgcttaatgccacagctatcgcagtagctgaggggacagatagggttatagaactgttacaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Meninges gp160 (Rev) B (B) (No) AF217175 10871768 2616 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggagttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtatattatggggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtaacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataattagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggagaggaatgctactaatactagtagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataagactagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattgggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggagaacaatttgggaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccggggggaggaaatatgaaggacaattggagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattgttgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttccatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaagggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcaattatctgggacgacctgcggggcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaagtattggtggaatctcctgcagtattgggggaaggaactaaagaatagtgctgttagcttgcttaatgccacagctatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Meninges gp160 (Rev) B (B) (No) AF217176 10871768 2644 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtctattatgaggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttaggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaatgccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaataaataatgatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaggataagaacttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatagaattaggccagtagtatcagctcaactgctgttaaatggcagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccaaggagagcattttatacaacaggagacataataagagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaggaataaaacaatacagtttcagccatcctcaggaagagacccagaaattgtaacacacagtctgaattgtggaggggaatttttctactgtaatacaacacacctgtttaatagtaattggactactattaatggtactacttggaatagtactgaaaggtcaaataacactgtaagaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccaggaggaggaaatatgagggacaattagagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattgttgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttccatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcaattatctggggcgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaagtattggtggaatctcctgcagtattgggggaaggaactaaagaatagtgctgttagcttgcttaatgccacagctatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Blood gp160 (Rev) B (B) (No) AF217177 10871768 2641 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaggcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaataccaatagtactatcgaggaagagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaacttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttgggaataaaacaatacagtttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacacacctgtttaatagtaattggactgggaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacacaatcagactctcatgcaggataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctccaatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccggtaacgataccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcgggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcagcagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagagctaaagaatagtgctgttagcttgctcaataccacggccatcgcagtagctgaggggacagatagggttatagaactattgcaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataaaatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Blood gp160 (Rev) B (B) (No) AF217178 10871768 2641 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaggcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaataccaatagtactatcgaggaagagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaacttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttgggaataaaacaatacagtttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacacacctgtttaatagtaattggactgggaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacacaatcagactctcatgcaggataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctccaatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccggtaacgataccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcgggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcagcagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatgaagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagagctaaagaatagtgctgttagcttgctcaataccacggccatcgcagtagctgaggggacagatagggttatagaactattgcaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataaaatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) Blood gp160 (Rev) B (B) (No) AF217179 10871768 2641 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaggcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacggaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaataccaatagtactatcgaggaagagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaacttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttgggaataaaacaatacagtttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacacacctgtttaatagtaattggactgggaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacataatcagactctcatgcaggataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctccaatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccggtaacgataccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcgggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcagcagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagagctaaagaatagtgctgttagcttgctcaataccacggccatcgcagtagctgaggggacagatagggttatagaactattgcaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataaaatgggtggcaagtggtcaaaa
546 HAD M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count AZT + ddI 96 60 Deceased 2000 United States (unknown) PBMC gp160 (Rev) B (B) (No) AF217180 10871768 2641 taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaggcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccgctagtactggcaagaatgttactaataccaatagtactatcgaggaagagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaacttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttgggaataaaacaatacagtttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacacacctgtttaatagtaattggactgggaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacacaatcagactctcatgcaggataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctccaatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccggtaacgataccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcgggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcagcagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgatctttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagagctaaagaatagtgctgttagcttgctcaataccacggccatcgcagtagctgaggggacagatagggttatagaactattgcaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataaaatgggtggcaagtggtcaaaa
99 No HAND M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count Unknown Therapy Status Unknown Therapy Status 30 AIDS 2001 Kenya (Nairobi) Brain Tat (gp160) A (?/D/D/D/A1/A1) (No) AF364107 11312658 1228 tttaacatgtggaaaaatgacatggtagaacagatgcatacagatataatcagtctatgggatgaaagcttacaaccatgtgtgaaattaaccccactctgtgtcactttaaactgcactgacactactaatgtcaataactcagaaccaatgaaaaactgctctttcaatatgaccacagaactaagggataagaaacagaaagtacattcacttttttatagacttgatgtggtacaaatagatgataataatagttctaataccaactataccaactatagattaataaattgtaatacctcagtcattacacaggcttgcccagaggtatcctttgagccaattcccatacattattgtgccccagctggttttgcgatcctaaagtgtaaggatgagaagttcaatggaacagggccatgcaagaatgtcagcacagtacaatgctcacatggaatcaagccagtagtatcaactcaactgttgttgaatggtagtctagcagaaggagaggttaaaattagatctgaaaatatcacaaacaatggcaaaaatataatagtacaacttgtcaaccctgtgaaaattgagtgtatcagacctaacaacaatacaagaaaaggtacacgtataggaccagggcaaacactctttacaacaagcataatagggaatataagacaagcatattgtaatgtcagtaaatcagcatggaataacactttacaacaggtaggtaaacaattaggagagtactttaagaacaaaacaattagatttaatggctcctcgggaggggacatagaaattacaacacacagttttaattgtggaggagaatttttctattgtaatacatcaggtctgttcaatggctcttggaatgccaatgccagcaatgccagcatgcaggagtcaaatgacactataactctccaatgcagaataaaacaaattataaatatgtggcagagagcaggacaagcagtgtatgcccctcccatccaaggagtaataaggtgtgaatcagacattacaggactgatattaacaagagatggtggggacaataataatacaagtgaaatcttcagacctggaggaggagatatgagagacaattggagaagtgaattatataggtataaagtagtaaaaattgaaccgctaggagtagcacccaccagggcaaggagaagggtggggagagagaaaaaagagcagt
99 No HAND M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count Unknown Therapy Status Unknown Therapy Status 30 AIDS 2001 Kenya (Nairobi) Spleen Tat (gp160) A (A1/?/A1/A1) (No) AF364108 11312658 1328 ctactgtctgggctcacatgcctgtgtacccacagaccccgacccacaagaaatacatttggaaaatgtgacagaagagtttaacatgtggaaaaatgacatggtagaacagatgcatacagatataatcagtctatgggatgaaagcttaaagccatgtgtaaaattaaccccactctgtgtcactttaaactgcactgacactactaatgtcaataactcagaaccaatgaaaaactgctctttcaatatgaccacagaactaagggataagaaacagaaagtacattcacttttttatagacttgatgtggtacaaatagatgataataatagttctaataccaactataccaactatagattaataaattgtaatacctcagtcattacacaggcttgcccaaaggtatcctttgagccaattcccatacattattgtgccccagctggttttgcgatcctaaagtgtaaggatgagaagttcaatggaacagggccatgcaagaatgtcagcacagtacaatgcacacatgaaatcaagccagtagtatcaactcaactgttgttgaatggtagtctagcagaaggagaggtaaaaattagatctgaaaatatcacaaacaatggcaaaaatataatagtacaacttgtcaaccctgtgaaaattgagtgtatcagacctaccaacaatacaagaaaaggtatacgtataggaccagggcaaacactctttacaacaagcataataggggatataagacaagcacattgtaatgtcagtaaatcagcatggaataacacttcacaacaggtaggtaaacaattaggagagtactttaaaaacaaaacaattagatttgataactcctcgggaggggacatagaaattacaacacacagttttaattgtggaggagaatttttctattgtaatacatcaggtctgttcaatggctcttggaatgccaatgccagcaatgccagcatgcaggagtcaaatggcacggagtcaaatgacactataactctccaatgcagaataaaacaaattataaatatgtggcagagagcaggacaagcagtgtatgcccctcccatccaaggagtaataaggtgtgaatcaaacattacaggactaatattaacaagagatggtggggacaataagaatacaagtgaaaccttcagacctggaggaggagatatgagagacaattggagaagtgaattatataggtataaagtggtaaaaattgaaccactaggagtagcacccaccagggcaaggagaagagtggggagagagaaaaaagagcagttggaaa
104 No HAND M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count Unknown Therapy Status Unknown Therapy Status 37 AIDS 2001 Kenya (Nairobi) Brain Tat (gp160) B (B) (No) AF364109 11312658 1347 cacatgcttgtgtacccacagaccccaacccacaagaaatacatttggaaaatttgacagaagagtttaacatgaggaaaaataacatggtagagcagatgcatacagatataatcagtctatgggaccaaagtctaaagccatgtgtaaagttaacccctctctgcgttactctaaattgtaataatgtcaccagtagtagtaataatggcaccagtagtagtaataataccaccagtaatggcaccatcgaagacatacaagaaatgaaaaactgctctttcaatataaccacagaaataagggataagaaaaagaaagtatattcacttttttataggcttgatatagtacaacttaatgaaaatcagaataatagtaataatagtagtgagtatagattaataaattgtaatacctcagccattacacaagcttgtccaaaggtatcctttgagccaattcctatacattattgtgccccagctggttttgcgattctaaagtgtaaggataaggagttcaatggaacagggccatgcaagaatgtcagtacagtacaatgcacacatggaatcaagccagtagtatcaactcaactgctgttaaatggcagtctagcagaagggaaggtaatgattagatctgaaaatattacaaacaatgctaaaaatataatagtacaatttaacgagactgtgaaaattaattgtaccagacctaacaataatacaagaaaaagtatatctataggaccaggacaagcattctatgcaacaggtgacataataggggatataagacaagcacattgtagtgtcaatggatcagaaaataaagctttacaacaggtagttacacaattaagaacatactttaagaataaaacaataatattcactggctcctcaggaggggatccagaaataacaacacatagtttcaactgtggaggagaatttttctattgtaacacatcaggcctgtttaatagcacctggaatagcactgagtcaaatagcacggggtcaaatgacactataaatctcccatgcagaataaagcaaattataaatatgtggcagagagcaggacaagcaatatatgcccctcccacccaaggaataataatgtgtaaatcaaacattacaggactaatattaacaagagatggtggtgggaatggtaacagtacaaatgaaaccttcagacctggaggaggagatatgagggacaattggagaagtgaattatataagtataaagtagtaaaaaaaaaaccactaggaatagcacccaccaagtcaaagagaagagtggtggagagaaagaaaagggcggtagtta
104 No HAND M Unknown Risk Factor Unknown Viral Load Unknown CD4 Count Unknown Therapy Status Unknown Therapy Status 37 AIDS 2001 Kenya (Nairobi) Spleen Tat (gp160) B (B) (No) AF364110 11312658 1243 acatggtagagcagatgcatacagatataatccatgtgtaaagttaacccctctctgcgttactctaaattgtaataatgtcaccagtagtagtaataatggcaccagtagtagtaataataccaccagtaatagcaccatcgaagacatacaagaaatgaaaaactgctctttcaatataaccacagaaataagggataagaaaaagaaagtatattcacttttttataggcttgatatagtacaacttaatgaaaatcagaataatagtaataatagtagtgagtatagattaataaattgtaatacctcagccattacacaagcttgtccaaaggtatcctttgagccaattcctatacatta