Patient: CodePatient: HAND StatusPatient: SexPatient: Risk FactorPatient: Viral Load At SamplingPatient: CD4 Count At SamplingPatient: HIV Therapy StatusPatient HIV Therapy MonthsPatient: Age At SamplingPatient Health At SamplingSampling: YearSampling RegionSampling: TissueSequence: Polyprotein (Protein)Genotyping InformationSequence: Accession NumberSEQUENCE PMIDSequence Length (nt)HIV Sequence
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00113710076507105tgtacaagacccaacaacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00113810076507105tgtacaagacccaataacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00113910076507105tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagaggattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00114010076507105tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00114110076507105tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagatataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00114210076507105tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00114310076507105tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00114410076507105tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00114510076507105tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00114610076507105tgtacaagacccaacaacaatacaagaaaaggtgtatatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenTat (gp160)B (#) #AB00114710076507105tgtacaagacccaacaacaatacaagaaaaggtataaatataggaccagggagaggattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainTat (gp160)B (#) #AB00116310076507105tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainTat (gp160)B (#) #AB00116410076507105tgtacaagacccaacaacaatactagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainTat (gp160)B (#) #AB00116510076507105tgtacaagacccaacaacaatacgagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainTat (gp160)B (#) #AB00116610076507105tgtacaagacccaacaacaatacaagaaaaggtatacatatagggccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainTat (gp160)B (#) #AB00116710076507105tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagggcattattttatgcaacagacataataggagatataagacaagcacattgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainTat (gp160)B (#) #AB00116810076507105tgtactagacccaacaacaatacaaggaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacactgt
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00116910076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaggacaggactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117010076507105atggaaaaggaaggaaaaatctcacaaattgggtctgaaaatccatacaatactccagtatttggcataaagaaaaaggacagtactaaatcgagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117110076507105atggaaaaggaaggaaaaatttcacaaattgggcctgaaaatccacacaatactccagtattgggcataaagaaaaaggacaggactaaatggagaaaattagga
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117210076507105atggaaaaggaagggaaaatagcacatcttgggcctgataatccatacaatactccagcattgggcataaagaaaaaggacaggactaaatggagaaaattagga
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117310076507105atggaaaaggaaggaaaaatttcacaaattgggcctgataatccatacaatactctagtatttggcataaagaaaatggataggactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117410076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagataaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117510076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggataaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117610076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggataagaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117710076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaataggacagcataggataaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117810076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggataaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00117910076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00118010076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaagaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00118110076507105ttagaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00118210076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00118310076507117tatcaatacatgaatgatttgtatgtggaatctgacttagaaatagggcagcataggacgagaatagaggaactgagagaacattttttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00118410076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaggaatagaggagctgagaggacatctgttaaggtggggattttacacaccatacaag
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SerumPol (RT)B (#) #AB00118510076507117tgtcaatacatggatgatttgtatgtaggatctaacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00118610076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagattgagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00118710076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00118810076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00118910076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119010076507105ctggaaaagaaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119110076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgagaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119210076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactaaatggagaaacttagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119310076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119410076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119510076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119610076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgcaataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119710076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaaaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119810076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtacttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00119910076507105tgggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacactactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120010076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120110076507105tgggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120210076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120310076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtattcgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120410076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120510076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120610076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120710076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctattaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120810076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00120910076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaattagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121010076507117tatcaatacatggatgatttgtatgtaggatctggcttagaaatagggcagcatagaacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121110076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaattagaggaactgagagaacatctgttacggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121210076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaattagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121310076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121410076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121510076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatacctgttaaggtggggattttacacaccagacaag
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121610076507117tatcaatacatggatgatttgtatgtaagatctgacttagaaatagggcagcataggacaaaaatagaggaactgaaagaatatccgttaaggcggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121710076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121810076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00121910076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaaccgagagaatatctattaaggtggggattttacacaccagacaac
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00122010076507117tatcaaaacatagatgatatgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggatctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00122110076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00122210076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctattaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00122310076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00122410076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcaacataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)SpleenPol (RT)B (#) #AB00122510076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00122610076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00122710076507105atggaaaaggaaggaaaaatttcaagaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00122810076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00122910076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123010076507105ttggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123110076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123210076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagaggacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123310076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatggagcagaaatagaggagctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123410076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcaacataggacgaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123510076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacgaaaatagaggagctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123610076507117tatcaagacatggatgatttgtatgtaggatctgacttagaaatagggcatcataggacaaaaatagagggactgagagaacatctgttgaggtggggagtttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123710076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123810076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaagatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00123910076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00124010076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttacggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00124110076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaataggggagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00124210076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggatctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)CSFPol (RT)B (#) #AB00124310076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggagctgagagaacatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00124410076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00124510076507105atgaaaaaggaaggaaaaatttcaaaaattgggcctaaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00124610076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00124710076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00124810076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00124910076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaactggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125010076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125110076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaagtccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125210076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125310076507105atgaaaaaggaaggaaaaatttcaaaaattgggcctaaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125410076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125510076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125610076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125710076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125810076507105atggaaaaggaaggaaaaatttcaagaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00125910076507105ctggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126010076507105atgaaaaaggaaggaaaaatttcaaaaattgggcctaaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126110076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126210076507105atggaaaaggaaggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaagaacagtactagatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126310076507105atgaaaaaggaaggaaaaattccaaaaattgggcctaaaaatccatacaatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagta
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126410076507117tatcaatacatggatgatttgtatgttggatctgacttagaaatagggcagcataggacaaaaatcgaggaactgagagaacatctgttatggtggggatttaccacaccagccaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126510076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126610076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126710076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126810076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00126910076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127010076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127110076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagataaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127210076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagataaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127310076507117tatcaatacatggatgatttgtatgtaggatctaacttagaaacagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127410076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaatatctgttaaggtggggattttacacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127510076507117tatcaagacatggatgatttgtatgtaggatctgacttagagatagggcagcataggacacaaatagaggggctgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127610076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127710076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127810076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggagctgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00127910076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00128010076507117tatcaatacatggatgatttgtatgtaggatctaacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00128110076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00128210076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaataggccagcataggacaaaaatagaggaactgagagaacatctgttaaggtggggattttacacaccagataaa
SUBJECT_4HIVE + ADCMUnknown Risk FactorUnknown Viral Load5 cells / ulAZT2029AIDS1993Japan (unknown)BrainPol (RT)B (#) #AB00128310076507117tatcaatacatggatgatttgtatgtaggatctaacttagaaataggtcagcataggacaaaaatagatgaactgagagaacatctgttaaggtggggatttaccacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00621110076507105ttggaaaaggaagggaaaatttcacaaattgggcctgataatccatacaatactccagtatttggcataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00621210076507105ttggaaaaggaagggaaaatttcacaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaagacagtactaatggagcaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00621310076507105ttggagaaagaagggaacatttcacaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00621410076507105ttggaaaaggaagggaacatttcacaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaagacagtactaaatggagaaaattagca
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00621510076507105ttggaaaaggaagggaaaatttcacaaattggacctgaaaatccatacaatactccagtatttggaataaagaaaaaagacaggactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00621610076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggaggaagttagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00621710076507105ttggaaaaggaatggaacatgtcacaaattgggcctgataatccttacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00621810076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgataatccatacaatactccagtatttgccataaggaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00621910076507105ttggaaaaggaatggaacatctcacaaattgggcctgataatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622010076507105ttggaaaaggaatggaacatgtcacaaattgggcctgataatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622110076507105ttggaaaaggaatggaaaatgtcaaaaattgggcctgataatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622210076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagagcagcatagaataaaaatagaggaactgagacaacatctgtggaaatggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622310076507117tatcaatatttggatgatttgtatgtaggatttgacttagagatagttcaccataggatctgtatagaggaactgagacaacatctgtggaggtggggattttccacaccaggcaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622410076507117tatcaatacatggatgatttgtatgtaggatctgactcagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtcgaagtgggggttttgcacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622510076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagggcagcatagaataaaaatagaggaactgagacaacatctgtcgaagtgaggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622610076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaatagaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622710076507117tatcagtacatggatgatttgtatgtaggatctgacttagagatagaacaacatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622810076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaatcgagacaacatctgtggaggtggggattttccacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00622910076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggatttaacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00623010076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaaccgagacaacatctgtggaggtggggattttccacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00623110076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaatcgagactacatctgtggaggtggggattttccacacctgacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00623210076507117tatcagtacatggatgatttgtatgtaggatctgacttagagatggaacagcatagaagaaaaatagaggaatcgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00623310076507105ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00623410076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00623510076507105ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00623610076507105ttggaaaaggaagggaaaatttcaaaaattgggcccgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00623710076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00623810076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttggcgtaaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00623910076507105ttagaaaaggaagggaaaatttcacaaattgggcctgaaaatccatacaatactccagtatttggcataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624010076507105ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624110076507105ttggaaaaggaagggagaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624210076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624310076507105ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624410076507105ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624510076507105ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624610076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatctgccataaagagaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624710076507105ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624810076507105ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00624910076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00625010076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00625110076507105ttggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00625210076507105ttagaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagataaaagacagtactaaatggagaaaattagta
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00625310076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00625410076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagagcatcatagaataaagatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00625510076507117tatcaatacatggatgatttgtatgtaggatctgacatagagatagaccagcatagagtcaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00625610076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaccagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00625710076507117tatcaatatatggatgatttgtatgtaggatctgacttagagatagtccagcatagaatcaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00625810076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagtccagcatagaataaaaatagaggaactgagacaacatctgcggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00625910076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagggcagcatagagtggagatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626010076507117tatcaatacatggatgatttgtatgtaggatctgacttagagataggacagcatagaataagaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626110076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626210076507117tatcaatacatggatgattcgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626310076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626410076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626510076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626610076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626710076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626810076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00626910076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00627010076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00627110076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagaataaaaatagaggaactgagacaacatctgtggaagtggggattctacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00627210076507117tatcaatacatggatgatttgtatgtaggatctgacttagagatagaacagcatagagtaaaaatagaggaactgagacaacatctgtggaagtggggattttacacaccagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00627310076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00627410076507105ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00627510076507105ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00627610076507105ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00627710076507105ctggaaaaggacggtaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00627810076507105ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattaata
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00627910076507105ctggaaaaagatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattaata
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628010076507105ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628110076507105ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628210076507105ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628310076507105ctggaaaaggacggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacaatgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628410076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628510076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628610076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggatctaccacaccagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628710076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628810076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00628910076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaataggacaacatagaacaaaaatagaggaactgggacaacatctgttgaggtggggatttaccacaccagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00629010076507117tatcgatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaaatagaggaactgagacaacatctgttgaggtggggatttaccacaccagacaga
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00629110076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00629210076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggattttacacaccagacaga
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00629310076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctatggaagtggggattttacacaccagacaga
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)SpleenPol (RT)B (#) #AB00629410076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaataggacaacatagaacaaaagtagaggaactgagacaacatctgtggaggtggggatttaacacaccagacaga
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00629510076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaacaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00629610076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00629710076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgatagatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00629810076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00629910076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630010076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630110076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630210076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630310076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630410076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630510076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaaggacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630610076507105ctggaaaaggatggaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgctataaagaaaaagaacagtgataaatggagaaaattagta
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630710076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630810076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00630910076507117tatcaatacatggatgatttgtatgtaggctctgatttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00631010076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00631110076507117tatcaatacatggatgatttgtatgtaggctctgatttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00631210076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00631310076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00631410076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00631510076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00631610076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00631710076507117tatcaatacatggatgatttgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_1No HANDMUnknown Risk FactorUnknown Viral Load4 cells / ulAZT + ddI3333AIDS1999Japan (unknown)BrainPol (RT)B (#) #AB00631810076507117tatcaatacatggatgatctgtatgtaggctctgacttagaaatagaacaacatagaacaaaagtagaggaactgagacaacatctgtggaagtggggattttacacatcagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723010076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723110076507105ttggaaaaggaagggaaaatttctaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaagttagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723210076507105atggaaaaggaagggaaaatttcaaaaattggacctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaagttagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723310076507105atggaaaaggaagggaaaatctcaaaaattgggcctgagaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723410076507105atggaaaaggaacaaaaaatttctaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723510076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaggttagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723610076507105atggaaaaggaagaaaaaatttctaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtattaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723710076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723810076507105atggaaaaggaacgaaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaagttagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00723910076507105atggaaaaggaagggaaaatttcaaaaattggacctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00724010076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaagttagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00724110076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00724210076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00724310076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccacacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00724410076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00724510076507105atggaaaaggaagggaaaatttcaaaaattgggcctgagaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00724610076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacagtactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00724710076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00724810076507105atggaaaaggaagggaaaatttcaaaaattgggcctgaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagta
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00724910076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctattgaagtggggattcaacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00725010076507117tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctattgaagtggggattcaacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00725110076507117tatcaatacatagatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctattgaagtggggattcaacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)Unknown TissuePol (RT)B (#) #AB00725210076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggtagcatagaacaaagatagaggaactgagacaacatctattgaagtggggattcaacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00725310076507117tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00725410076507117tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacgaaaatagaggaactgagacaacacctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00725510076507117tatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)Unknown TissuePol (RT)B (#) #AB00725610076507117tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcattgaacaaaaatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)Unknown TissuePol (RT)B (#) #AB00725710076507117tatcaatacatggatgatttgtatgttggatctgatttagaaatagggtagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00725810076507117tatcaatacatggatgatttgtatgttggatctgatttagaaatagggcagcatagaacaaagatagaggaactgagacaacatctagtgaagtggggattcaacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)SpleenPol (RT)B (#) #AB00725910076507117tatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggatttgacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00726010076507117tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00726110076507117tatcgttacgaggattatttgtatgttggatgtgatttagaaatagggcagaataggacaaatatagaggaattgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00726210076507117tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00726310076507117tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00726410076507117tatagttacgaggatgatttgtatgtaggatcagatttagaaatagggcagcataggacaaatatagaggaattgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00726510076507117tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00726610076507117tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_2No HANDMUnknown Risk FactorUnknown Viral Load1 cell / ulAZT1226AIDS1996Japan (unknown)BrainPol (RT)B (#) #AB00726710076507117tatcattacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaatatagaggaactgagacaacatctgttgaagtggggattttacacaccagacaaa
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00726810076507105tgtacaagacccaacaacaatacaagaaaaaggataactataggaccaaggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00726910076507105tgtacaagacctaacaacaatacaagaaaaaagataactataggaccagagaaagtattttatacaacaggacaaataataagagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727010076507105tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727110076507105tgtacaagacccaacaacaatacaagaaaaaggataactataggaccaaggaaagtattttatacaacaggacaaataataggagatataaaaaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727210076507105tgtacaagacccaacaacaatacaaaaaaagggataactataaaaccaggaaaagtattttatacaacaggacaaataataagagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727310076507105tgtacaagacccaacaacaatacaaaaaaagagataactataaaaccaaggaaagtattttatacaacaggacaaataataggagatataagacaaacacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727410076507105tgtacaaaacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727510076507105tgtataagacttaataacaatacaagaaaagggataactatgggactagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727610076507105tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727710076507105tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcatattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727810076507105tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggagagtattttatacaacaggacaaataataggaaatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00727910076507105tgtacaagacccaacaacaatacaagaaaagggataactataggaccaaggaaagtattttacacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00728010076507105tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggagaaataataggagatataagaaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00728110076507105tgtacaaaacccaacaacaatacaagaaaaaggataactatggaaccaaggaaagtattttatacaacaggacaaataataggagatataaaacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)SpleenTat (gp160)B (#) #AB00728210076507105tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00728310076507105tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataaggaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00728410076507105tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00728510076507105tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00728610076507105tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00728710076507105tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00728810076507105tgtacaagacccaacaacaatacaagaaaaaggataactataggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00728910076507105tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00729010076507105tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00729110076507105tgtacaagacccaacaacaatacaagaaaaaggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagaaaagcacattgt
SUBJECT_3HIVEMUnknown Risk FactorUnknown Viral Load2 cells / ulAZT3619AIDS1996Japan (unknown)BrainTat (gp160)B (#) #AB00729210076507105tgtacaagacccaacaacaatacaagaaaagggataactatgggaccagggaaagtattttatacaacaggacaaataataggagatataagacaagcacattgt
144HANDUnknown SexUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeUnknown Patient HealthUnknown YearUnknown RegionBrainTat (gp160)B (#) #AF125830103811691042accccactctgtgttactttaaattgcactgattggaagaatagtactaataccaatagtagtagtaataccataagagagatagagaaaggagaaataaaaaactgctctttcaatattaccacaagcataagagataaggtaaagaaagaatatgcacttttttatagacctgatgtagtaccaatagataatgataatactagttataggttgataaattgtaacacctcaaccattacacaagcctgtccaaaagtatcctttgagccaattcctatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaaattcagtggaaaaggaacatgtaaacctgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagcctagcagaagaagaggtagtaattagatctgacaatttcacgaacaatgttaaaaccataatagtacagctgaaagaagctgtagaaattaattgtacaagacccagcaacaatacaagaagaagtataaatataggaccagggagagcattttatacaacggaacaaataacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatagcaatttacaacagatagttaaaaaattaaaagaacaatttaggaatgcaacaacaatagtctttaatcaatcctcaggaggggacccagaaattgtaacacacagttttaattgtggaggggaatttttctactgtaacacatcaaaactgtttaatagtacttggattggaaatgatactaataacactgaagaaaatagcacactccctatcacactcccatgcagaataagacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacgaattagttgctcatcaaatattacagggctgctattgacaagagatggtggtactaacacaaataggactgagaccttcagacttggaggag
222HANDUnknown SexUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeUnknown Patient HealthUnknown YearUnknown RegionBrainTat (gp160)B (#) #AF125871103811691023accccactctgtgttactttaaattgcactgatttgaaaaataagactattgccaataatgatacagagatagaaatgaaaaactgctctttcaagatcacctcaaacatgagagataaaatgcatacggaatatgcacttttttataaacttgatatagtacaaatagataatgataatactagctataggttaataagttgtaacacctcagtcattacacaggcttgtccaaaggtatcctttgaaccaattcccatacattattgtaccccgcctggttttgcacttctaaagtgtaaggataagaagttcaatggaacaggaccatgtaaaaatgttagcacagtacaatgtacacatggaattaagccagtagtgtcaactcaactgctattaaatggcagtctagcagaagaagaggtaataattagatctaagaattttagtaataatgctaataacataatagtacagctaaatgaatctgtagcaattaattgtacaagacctaacaacaatacaagaaaaagtatacatatggtaccaggaaaagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacctcagtgaaacagactggaataaaaccttaaaacatgtagccgaaaaattaagagaacaatttaaagcaacacgaatagtctttgatcaatcctcaggaggggacccagaaattgtaatgcacagttttaattgtggaggggaatttttctactgtaatacaacacccctgtttaatagtacttggagtagtaatagtactatttcaaatgggactggaaagtcaaataatatcacactccaatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtacgcccctcccatcaaaggacaaattagatgttcatcaaatattacagggctgctattaacaagagatggtggtaataacagaaatgggactgaggtcttcagacttggaggagaagct
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17469210482626206aaagagtttttagagctgttatccatatacctagacggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggaggcgatggcctgctgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgagacct
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17469310482626226aaagagcttttagagctgttatcctcatacctaggcgaataagacagggctttgaaagggctttgctagaagatgggtggtaagtggtcaaaaagcagtaggatgggatggcctgcggtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgggacctggaaagacatggagcaatcacaagtagcaata
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17469410482626226aaagagcttttagagctgttatcctcatccctaggcgaataagacagggctttgaaagggctttgctagaagatgggtggtaagtggtcaaaaagcagtaggatgggatggcctgcggtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgggacctggaaagacatggagcaatcacaagtagcaata
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17469510482626238aaagagtttttagagctgttatccatatacctagacggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggatgggatggcctgctgtaagggaaagaatgagacgagctgagccagcagctgagccagcagcagatggggtgggagcagcatctcgagacctggaaagacatggagcaatcacaagtagcaata
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17469610482626205aaagagtttttagagctgttatccatatacctaggcggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggacgggatggcctgctgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgagacc
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17469710482626226aaagagcttttagagctgttatcctcatccctaggcgaataagacagggctttgaaagggctttgctagaagatgggtggtaagtggtcaaaaagcagtaggatgggatggcctgcggtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgggacctggaaagacatggagcaatcacaagtagcaata
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17469810482626238aaagagtttttagagctgttatccatatacctagacggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggacgggatggcctgctgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatgggatgggagcagcatctcgagacctagaaagacatggagcaatcacaagtagcaata
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17469910482626226aaagagcttttagagctgttatcctcatccctaggcgaataagacagggctttgaaagggctttgctagaagatgggtggtaagtggtcaaaaagcagtaggatgggatggcctgcggtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgggacctggaaagacatggagcaatcacaagtagcaata
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeNef (gp160)B (#) #AF17470010482626219aaagagcttttagagctgttatccacatacctaggcgaataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggagtggatgggatactgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgagacctggaaagacatgga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeNef (gp160)B (#) #AF17470110482626238aaagagcttttagggctgttatccacatacctaggcgaataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggagtggatgggatactgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagctggggtgggagcagcatctcgagacctggaaagacatggagcaatcacaagtagcaata
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17470210482626238aaagagcttttagggctgttatccacatacctaggagaataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggagtggatgggaaactgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagctggggtgggagcagcatctcgagacctagagagacatggagcaatcacaagtagcaata
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainNef (gp160)B (#) #AF17470310482626238aaagaggttttagagctgttatccatatacctagacggataagacagggctttgaaagggctttgctataactttgctaataagatgggtaataagtggtcaaaaagtagtaggacgggatggtctgctgtaagggaaagaatgagacgagctgagccagcagcagagccagcagcagatggggtgggagcagcatctcgagacctagaaggacatggagcaatcacaagtagcaata
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17470410482626269ccccactctgtgttactttaaagtgtaaagatgtggggaatactactaatatcactagtagcagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataaaagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17470510482626269ccccactctgtgttactttaaagtgtgatgatgtgaggaataaaactaatatcactattagcagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagagataaggtgcagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatgataatactagctataggttgttaagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17470610482626263ccccactctgtgttactttaaggtgtactgatgtgaggaataatactaataccactagtaatagctgggaaaagatggaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17470710482626263ccccactctgtgttactttaaggtgtactgatgtgaggaataatactaataccactagtaatagctgggaaaagatggaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17470810482626269ccccactctgtgttacgttaaggtgtactgatgtgaggaataatactaacaccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagaaagaacatgcacttttttataaccttgatgtagtaccaatagataatgataatgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17470910482626269ccccactctgtgttacgttaaggtgtactgatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagaaagaacatgcacttttttataaccttgatgtagtaccaatagataatgataatgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471010482626263ccccactctgtgttactttaaagtgtactaatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagcaagaacatgcacttttttataaacttgatgtagtaccaatagataataataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471110482626263ccccactctgtgttactttaaagtgtactgatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagcaagaacatgcacttttttataaacttgatgtagtaccaatagataataataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471210482626263ccccactctgtgttactttaaagtgtactgatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagcaagaacatgcacttttttataaacttgatgtagtaccaatagataataataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471310482626263ccccactctgtgttactttaaagtgtactgatgtgaggaataatactaataccactagtagtagctgggaaaagatggagaaaggagaaataaaaaattgctctttcaatatcaccacaagtataagtgataaggtgcagcaagaacatgcacttttttataaacttgatgtagtaccaatagataataataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471410482626170gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtcc
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471510482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccagaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471610482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccagaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471710482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471810482626164gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggc
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17471910482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataaggctagctataggttgataagttgtaacacttcagttattacacaggcctgtccaaaggn
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17472010482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccagaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17472110482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17472210482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17472310482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17472410482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgaagtagtaccaatagataataataagactagctataggttgataagttgtaacacttcagttattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17472510482626182gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaacagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17472610482626182gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaatatgcacttttttataaacttgatgtagtaccaacagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggccagtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17472710482626182gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaatatgcacttttttataaacttgatgtagtaccaacagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17472810482626181gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcatacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17472910482626182gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17473010482626182gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17473110482626182gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17473210482626182gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17473310482626182gagaaaggaggaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaatagataatgatgatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17473410482626182gagaaaggagaaataaaaaattgctctttcaaagttaccacaagcataagagataagacgcagatagaacatgcacttttttataaacttgatgtagtaccaacagataatgataatgatagtactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17473510482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17473610482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17473710482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17473810482626162gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcaataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattaataagttgtaacacctcagtcattacacag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17473910482626163gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacagg
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17474010482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17474110482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17474210482626176gaaaaaggagaaataaaaaattgctctttcgatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtatcaatagataataataagactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17474310482626176gagaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcaataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattaataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17474410482626176gaaaaaggagaaataaaaaattgctctttcaatatcaccacaagcataagcgataaggtgcagaaagaacatgcacttttttataatcttgatgtagtaccaatagataataataagactagctatagattaataagttgtaacacctcagtcattacacaggcctgtccaaaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17474510482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaggacagcactaaatggagaaaattagtagatttcagagaacttaataagaggactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccaggaattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaattgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17474610482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagtagatttcagagaacttaataagaggactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccaggaattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaattgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17474710482626585aaaaaataaaagcattagtagaaatktgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagaggactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccattcctagtgtaaacaatgagacaccaggaattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttaggaaagaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgacttagaaataggacagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17474810482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgacttagaaataggacagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17474910482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17475010482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17475110482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodePol (RT)B (B) (No)AF17475210482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatgaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17475310482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17475410482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgccataaagaaaaaggacagtactaaatggagaaaattagtagatttcagagaacttaataagaggactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccttagataaagaattcaggaagtatactgcatttaccatacctagtataaacaatgagacaccaggaattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaattgagacagcatctgttgaggtggggatttaccacaccagacaaaaaatatcagaaan
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainPol (RT)B (B) (No)AF17475510482626585aaaaaataaaagcattagtagaaatctgtacagaaatggaaaaggaagggaaaatttcaaaaattgggcctgacaatccatataatactccagtatttgctataaagaaaaaagacagtactaaatggagaaaattagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattaggaataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgatgcatatttttcagttcccctagataaagaattcaggaagtatactgcatttaccatacctagtgtaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaatattccaatgcagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgatttagaaatagggcagcatagaacaaaaatagaggaactgagacagcatctgttgaggtggggatttaccacaccagacaaaaaacatcagaaag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17475610482626243gtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacatctgaataaatctgtagcaatccattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggggacataataggagatataagacaagcacattgtaacattagtagggcagactggaataacactttaaaacaggtagctataaagttaagaaaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17475710482626243gtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtgtacatataacaccaggcagagcattttatgcaacaggagacattataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17475810482626243gtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17475910482626243gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgaataaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcgcagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcaaaatgggagaacactttaaaacaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17476010482626243gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgaataaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcgcagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcaaaatgggagaacactttaaagcaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17476110482626243gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgaataaatctgtagcaattaattgtataagacccaacaacaatacaagaaaaggtatacatatagcaccaggcgcagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagtaaaatgggagaacactttaaaacaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17476210482626243gtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17476310482626243gtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaactgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17476410482626241aattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagacataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagacaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17476510482626243gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17476610482626243gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtgcagcattttatacaacaggagacataataggagatataagacaagcacattataaccttagtaaagcagaatgggagaacactttaaaacaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17476710482626235atctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17476810482626243gtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcactctatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17476910482626243gtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgactaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagagaacaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17477010482626243gtaattaggtctgaaaatttctcagacaatgctaaaactataatagtacatctgaatraatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatrggaccagggagagcattgtatacaacaggacaaataataggaaatataagacaagcacattgtaacattagtagagaaaaatggaataaaactttagaacagatagttataaaattaggagaaaaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17477110482626241aattagatctgaaaatttctcagacaatactaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccagggagagcattttatacaacaggacaaataataggaaatataagacaagcacattgtaacattagtagagaaagatggaataaaactttagaacagatagttaaaaaattaggagaaaaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17477210482626236ggtctgaaaatttctcgaacaatgctaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaacgtttaggacagatagctataaaattaagagaaaaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17477310482626243gtaattagatctgaaaatttctcgaacaatgctaaaactataatagtacatctgaatgaatctgtagaaattaattgtataagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagatagctataaaattaagagaaaaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17477410482626237agatctgaaaatttctcgaacaatgttaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagctagctataaaattaagagaaaaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17477510482626243gtaattagatctgaaaatttctcgaacaatgttaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagatagctataaaattaagagaaaaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17477610482626243gtaattagatctgaaaatttctcgaacaatgttaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagatagctataaaattaagagaaaaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17477710482626243gtaattagatctgaaaatttctcgaacaatgctaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcaatttatacaacaggacaaataataggagatatcagacaagcacattgtaacattagtagagcaaaatggaataaagctttaggacagatagctataaaattaagagaaaaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848Unknown Patient Health1999United Kingdom (unknown)SpleenTat (gp160)B (#) #AF17477810482626234tctgaaaatttctcggacaatgctaaaactataatagtacatctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaacgtataactatgggaccagggagagtatattatacaacaggacaaataataggaaatataagacaagcacattgtaacattagtagagaaagatggaataaaactttagaacagatagttataaaattaggagaaaaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17477910482626243gtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaayaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17478010482626243gtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatcgaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17478110482626243gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtagaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17478210482626243gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagayataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17478310482626230aaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17478410482626230aaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17478510482626231gaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17478610482626231gaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagaacaaratggaataaaactttaaaacagatagttatcaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17478710482626231gaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17478810482626231gaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17478910482626242taattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479010482626242taattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479110482626243gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaagrcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaa
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479210482626207gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataac
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479310482626243gtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaagrcccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479410482626243gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaggwatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479510482626243gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctrtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagagcattttatacaacaggagaaataataggaaatataagacaagcacattgtaaccttagtagaacagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479610482626243gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaggaatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479710482626243gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctatagaaattaattgtacaagacccaacaacaatacaaggaaaggtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479810482626243gtaattagatccgccaatttcacaaacaatgctaaagtcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattctatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtggagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17479910482626243gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17480010482626243gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccaggcagagcattctatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtagagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17480110482626243gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaaccttagtagagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17480210482626243gtaattaggtccgccaatttcacaaacaatgctaaagtcataatagtacagctaaataaatctgtagaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatcgaacaggagaaataataggaaatataagacaagcacattgtgaccttagtaaagcagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17480310482626243gtaattagatcagccaatttcacaaacaatgctaaagtcataatagtacagctgaataaatctatagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatcgaacaggagaaataataggaaatataagacaagcacattgtaaccttagtggaacagcatggaatgacactttaaaacagatagttataaagttaagagaacaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17480410482626264ctagcagaagaagaggtagtaattagatctgaaaatttctcaaacaatgctaaaaccgtaatagtacagctgactaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactctaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17480510482626264ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgctaaaatcataatagtacatctgaataaatctatagcaattaattgtacaagacccaacagcaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggcgatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaaaacaggtagctatgaagttaagagaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17480610482626264ctagcagaagaagggatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaataaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagaacagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17480710482626264ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgactaaacctgtagcaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgcaaccttagtagagcagcctggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17480810482626264ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgctataaccataatagtacagctgactgaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtagccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17480910482626264ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagacataagacaagcacattgtaaccttagcagaacagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17481010482626264ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacatctgaataaatctgtagcaatccattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggggacataataggagatataagacaagcacattgtaacattagtagggcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17481110482626273ctagcagaagaagaggtagtaattagatctgaaaatttctcaaaatttctcaacaacgctaaaaccataatagtacagctgactaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17481210482626264ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtgtacatataacaccaggcagagcattttatgcaacaggagacattataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17481310482626264ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgaccaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggagacataataggagacataagacaagcacattgtaaccttagcagaacagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17481410482626264ctagcagaagaagaggtagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacatctgaataaatctgtagcaatccattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggcagagcattttatgcaacaggggacataataggagatataagacaagcacattgtaacattagtagggcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17481510482626264ctagcagaagaagaggtagtaattagatctgaaaatttctcaaacaatgctaaaaccataatagtacagctgactaaacctgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatatagcaccaggtagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcagactggaataacactttaaaacaggtagctataaagttaagaaaacaattt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17481610482626266ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17481710482626266ctagcagaagaagacatagtaattagatctgcaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17481810482626266ctagcagaagaagagatagtaattagatctgaaaatttctcaaacaatgttagaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttaagacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17481910482626266ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482010482626266ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482110482626266ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagctattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttaagacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482210482626266ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggggacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482310482626266ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaactatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482410482626266ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaactgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482510482626266ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482610482626266ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482710482626266ctagcagaagaagacatagtaattagatctgaaaatttctcaaacaatgctaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggtacagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtaaagcagaatgggagaacactttaagacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482810482626266ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtagagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17482910482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagtaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagacgaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483010482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagtaccaggcacagcattttatacaacaggagacataataggagacataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483110482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483210482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483310482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483410482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483510482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483610482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaataatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483710482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcatttcatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagaggacaatatca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483810482626266ctagcagaagaagaaatagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatatgagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17483910482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17484010482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagactactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17484110482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17484210482626266ctagcagaagaaggggtagtaattagatctgaaaatttctcaaacaatgttaaaaacataatagtacagctgactaaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcacagcattttatacaacaggagacataataggagatataagacaagcacattgtaacattagtaaagcagaatgggagaccactttacaacaggtagctataaagttaagagaacaatttca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17484310482626400agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggccgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataagggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17484410482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcaggaaaaagcacagcaagcacagcgagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17484510482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctagcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagcagataaaggaagagcaaaacaaaaataagataaaagtacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17484610482626400agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagatacccaggaagctttagagcagataaaggaagagcaaaacaaaagtaagataaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17484710482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagatagaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17484810482626400agggggaaagaaaagatataaattaaagcatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtacagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17484910482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcacggcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17485010482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacaccaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17485110482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagacagaggaagagcaaaacaaaagcaagaagaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17485210482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagataggatcagaagaacttagatcattatttaatacagtagcgaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctctagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17485310482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagtacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctaaaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17485410482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17485510482626381tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatgcaatagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacaacgagcagcagctgccacaggaaacagcagccaggtcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17485610482626381tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcaggcaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17485710482626382tatcaattaaaacatatagtatgggcaagcaaggaactagaacgattcgcagttaatcctggcctattagaaacagcagaaggctgtagacaaataatagaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaagtcagccaggtcagccaaaattaccctatagtgcagaacctacaagggcaaatggtacatcaggccatatcacctagaactttaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17485810482626381tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaasarkaragcaswscaagcagcarsagacgcaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17485910482626381tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486010482626381tataaattaaagcatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatactagaacagctacaatcatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaagaatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaacctacaggggcaaatggtacatcaggccatatcacctagaacttta
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486110482626381tatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacagcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaaaatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaaccttcaagggcaaatggtacatcaggccatatcacctagaactttaaat
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486210482626382tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaactttaa
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486310482626372tataaattaaaacatatagcatgggcaagcatagaacaagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaggacaccaaggaagctttagataaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagctgacacaggaaacagcagccaagtcaaccaggtcagccaaaattaccctatagtgcagaacctacaagggcaaatggtacatcaggccatatcacctaga
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486410482626381tataaactaaaacatatagtatgggcaagcatagagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaagagctacaaccatcccttcaggcaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaargcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaacctacaggggcaaatggtacatcaggccatatcacctagaacttta
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486510482626381tataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatactagaacagctacaatcatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaaaatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaacctacaggggcaaatggtacatcaggccatatcacctagaacttta
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486610482626375tataaattaaaacatatagcatgggtaaaagtagtagaagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattaggacaactacaatcatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaacctacaggggcaaatggtacatcaggccatatcacctaga
NA173HIVEMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountZDV534AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486710482626381tataaattaaaacatatagtatgggcaacaatagaacaagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaargatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaaggaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaagtcagccaggccagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaacttta
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486810482626414gggggaaagaaaaaatatcaattaaaacatatagtatgggyaagcrmggtgttagaaaaattcgcaattaatcctggcctgttagaaacatcagaaggttgtagacaaatactgggacagctacaaccagcccttcagacaggatcagaaggacttaaatcattatataatacagtagcaaccctctattgtgtgcatcgaatgatagaggtaaaagacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagaagctggcacaggacacagcagccaggccgcagctrgcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17486910482626414gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcrgggwgttagaakrattcgcartyaatcctggcctgttagaaacatcagaaggytgtagacaaataytgggacagctacaaccagcccttcagacaggatcagaaggacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaggacaccaaggaagctctagycaagatagaggaagagcaaaagaaaagtaagaaaaaggcacagcaagcagcagctggcacaggacacagcagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487010482626396gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaatattrgaacagctacaaccatcccttaggacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacaaccaggccgcagctagcacaggaaacagcagccagatcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcag
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487110482626414gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcrgggwgctagaakrattcgcaatyaaccctggtctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccamcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487210482626413gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggwgctagaakrattcgcartyaatcctggcctmttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaac
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487310482626415gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaakrattcgcartyaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccamcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactt
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487410482626415gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtyaaccctggtctgttagaaacatcagaaggctgcagacaaatactggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctrgcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactt
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487510482626413gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaatattgggacagctacaaccatcccttkagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaagagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaac
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487610482626414gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcacaggaaacagcagccaggtcagccaaaattaccctatagtgcgraacctacagggacaaatggtacatcaggccatatcacctagaact
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487710482626414gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaataytggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacagggacaaatggtacatcaggccatatcacctagaact
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487810482626414gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggtgctagaacgattcgcagtyaatcctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcarccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17487910482626414gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaracatcagaaggctgcagacaaatattggaacagctacaaccamcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaact
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17488010482626397gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaaccaskrgcaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcagg
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17488110482626396gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcwttatttaatacagtagcaaccctctattgtgtgcatcaagggatagtggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcag
UK1_NA21HIVEFIV Drug UserUnknown Viral Load87 cells / ulZDV + ddC1249Deceased1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17488210482626412gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcwttatttaatacagtggcaaccctctattgtgtgcrtcgagggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaa
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17488310482626367atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcaatcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagacagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatcacctaga
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17488410482626370atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtacatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagccagcaacagcagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17488510482626361atataaattaaaacatatagtatgggcaagcagggagytagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatca
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17488610482626367atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatattagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagccagcagcagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17488710482626361atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17488810482626361atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17488910482626373atataaattaaaacatataatatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagagacatcagaaggctgtagacaaatattagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagccagcacgagcaacggcagcagctgccacaagaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17489010482626361atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagataccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatca
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17489110482626361atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgaatagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacaaccagcagcagctgccacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatca
NA128HIVEMUnknown Risk FactorUnknown Viral Load4 cells / ulZDV + ddC1848AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17489210482626361atataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctagcctgttagaaacatcagaaggctgtagacaaatactaggacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatgcagtagcagtcctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaataaaagtaagaaaaaagcacagccagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaacctccaggggcaaatggtacatcaggccatatca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)SpleenGag (p17)B (B) (No)AF17489310482626372atatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaagtcattatttaatcgagtagcagtcctctattgtgtacatcaaaggatagaggtaaaagacaccaaggaagctttagataagatagaggaagagcaaatcaaaagtaagaaaaaagcacagccagcagcagcagcagcagctgacacaggaaacagcagccaggtcagccaaaactaccctatagtgcagaaccttcaggggcaaatggtacagcaggccatatcacc
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17489410482626400agggggaaagaaaagatataaattaaagcatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtacagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17489510482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17489610482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcaggaggctatagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17489710482626399gggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17489810482626399gggggaaagaaaagatataaattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaggtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17489910482626399gggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490010482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagnaagcagcagctggcacaggaaacagcagccaggccaaccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490110482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcgaaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490210482626400agggggaaagaaaagatataaattaaagcatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcaccgaaagatagatgtaaaagacaccaatgaagctttagaaaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490310482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcgaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaggaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490410482626400agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggccgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataagggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490510482626397gggaaagaaaacatataaattaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490610482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggagcagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataagggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490710482626397gggaaagaaaacatataaattaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490810482626397gggaaaaaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17490910482626397gggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattagagcagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatgcagtagcaactctctattgtgtgcatcaaaggataaaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctgacacaggaaacagcggtcaggccagccaaaattaccctgtagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491010482626400agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagagagctagaacgattcgcagttaaccctagcctattagaaacatcagaaggccgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataagggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491110482626394aaagaaaacatataaactaaaacatatagtatgggcaagcagggaactagaacgattcgcagccaaccctggcctattagaaacatcagaaggctgtaaacaaatattggaacagctacaatcatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491210482626394aaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggagcagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaatgcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagcaggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491310482626397gggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattagagcagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatgcagtagcaactctctattgtgtgcatcaaaggataaaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctgacacaggaaacagcggtcaggccagccaaaattaccctgtagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491410482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcacggcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491510482626400agggggaaagaaaggatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491610482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacggcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491710482626397gggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491810482626397gggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagagcgattcgcagttcatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17491910482626397gggaaagaaaagatataaatcaaaacatatagtatgggcgagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492010482626399agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492110482626399aggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492210482626400aggggggaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492310482626399agggggaaagaaaaggtataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccccctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492410482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcaggaaaaagcacagcaagcacagcgagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492510482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaagaacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492610482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatatgggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccagggacaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492710482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492810482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaagatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17492910482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcaggaagaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17493010482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaagcagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17493110482626400agggggaaagaaaacatataaattaaaacatataatatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcaggaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17493210482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17493310482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagattaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17493410482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctagcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagcagataaaggaagagcaaaacaaaaataagataaaagtacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17493510482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacagccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagcagataaaggaagagcaaaacaaaaataagataaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17493610482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagagagctagaacgatttgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaagaatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaaccttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17493710482626400agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagatacccaggaagctttagagcagataaaggaagagcaaaacaaaagtaagataaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17493810482626400agggggaaagaaaacatatacattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaagtcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaatagcggtcaggccagtcaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17493910482626400agggggaaagaaaacatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagatacccaggaagctttagagcagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactctaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494010482626389aaacatatcaattaaaacatatagtatgggcaagcagggaactagaacgatttgcaattaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacggcaagcacagcaagcagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494110482626388aacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacaactacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaagaatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaagacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagtcaaaattaccctatagtacaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494210482626387aaaacatataaactaaaacatatagtatgggcaagcagggagctagaacggttcgcagttaaccctggcctgttggaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagagcttagatcattatgtaatgcagtagcaactctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacaagcagcagctggcacaggaaacagcggtcagaccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494310482626400agggggaaagaaaacatataaattaaaacatgtagtatgggcaagcagggaactagaacgatttgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaagcacagcaagcacagcaagcagcagctggcacaggaaatagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494410482626400agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggattgatgtaaaagacacccaggaagctttagagaagataaaggaagagcaagtcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaatagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494510482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcaattaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccctcagacagggtcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacacccaggaagctttagagaagataggggaagagcaaagcaaaagtcggaaaaaagcacagcaagcacagcaagcagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494610482626391gaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagcagataaaggaagagcaaaacaaaaataagataaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccaaccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494710482626389aaacatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaaacaaaaatcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494810482626390aaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggcctattagaagcatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagtacagcaagcacagcaagcagcagctgacgcaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17494910482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaaccctggtctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctgacacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17495010482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcggggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagctagtagcagctagcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)Lymph NodeGag (p17)B (B) (No)AF17495110482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagagagctagaacgattcgcagtcaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacggctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaagaatagatgtaaaagacacccaggaagctttagagaggataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaaacacagcaagtggcagctggcacaggaaacagtggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17495210482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacaccaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17495310482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17495410482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17495510482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagggcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccagaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17495610482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagctatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17495710482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcaggaagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccctcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17495810482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17495910482626400agggagaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496010482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496110482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcagtcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496210482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagacagaggaagagcaaaacaaaagcaagaagaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496310482626400ggggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccaaccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496410482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496510482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496610482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaatcatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcagggacaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496710482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496810482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17496910482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497010482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgcagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497110482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagacagatgtaaaagacaccaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaagaaggcacagcaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggcctcatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497210482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagataggatcagaagaacttagatcattatttaatacagtagcgaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctctagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497310482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497410482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497510482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtaggcaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497610482626386gatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctantgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttgtcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497710482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatgcagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497810482626399agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagctagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaa
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17497910482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498010482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498110482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggaactagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagatgtaaaagacaccaatgaagctttagagaggatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcaggcagcagctggcacaggaaacagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498210482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagtacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctaaaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498310482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgcagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcgcaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498410482626386gatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaagtattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtacaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcgcctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498510482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498610482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccgtcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccccctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacagaagtaagaaaaaagtacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498710482626390aaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498810482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccggccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17498910482626399gggggaaagaaaagatataaattaaaacatatagtatgggcaagctgggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499010482626400agggggaaagcaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagtacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499110482626400agggggaaagcaaagatataaattaaaacatataatatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499210482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagatagaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499310482626400agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499410482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499510482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcaaaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499610482626394aaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499710482626391gaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctttattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499810482626390aaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17499910482626400agggggaaagaaaacatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattagaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaactctctattgtgtgcatcaaaggatagatgtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagaaaaaagcacagcaagcacggcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500010482626400agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500110482626400agggggaaagaaaacatataaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacacccaggaagctttagagaagataaaggaagagcaaagcaaaagtcagcaaaaaacacagcaagcacagcaagcagcagctggcacaggaaacagcggtcaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccttatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500210482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500310482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcagggacaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500410482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccccatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500510482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500610482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500710482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500810482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17500910482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatcgagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17501010482626400agggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccccatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128AIDS1999United Kingdom (unknown)BrainGag (p17)B (B) (No)AF17501110482626399gggggaaagaaaagatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaatgaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcacagcatgcagcagctggcacaggaaatagcagtcaggccagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17501210482626261tcaacacaactgtttaatagtacttggaatgatactgatactgaaaggacaaatatcactgaaggaaatggtaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagttggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17501310482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17501410482626236tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgataaacatgtggcaggaaataggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17501510482626252tcaacacagctgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccctgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggcattaacacaagagacaacaagacagagatcttcggacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17501610482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17501710482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17501810482626261tcaacacaactgtttaatagtacttggaatgatactgatactgaaaggacaaatatcactgaaggaaatggtaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17501910482626258tcaacacgactgtttaatagtacttggaatggtactgaagggacaacaaatatcactgaaggaaatggtaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacgagacagaggtcttcagacctgtaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502010482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaaccaataacactggggaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502110482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgctcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502210482626252tcaacacaactgtttaatggtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaagaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502310482626255tcaacacaactgtttaatagtacttgggataggcctgaagggacaaatatcactgaaggaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502410482626252tcaacacaactgtttaatggtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502510482626251tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatccccctcccatcagaggacaaattagatgttcatcaaatattacgggatgattttaacaagagatggtggtattaacacaagagacaagaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502610482626249tcaacacaactgtttaatagtacttgggatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaatgaaacaaattataaacatgtggcaggaagcaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtaataccacgaacgcgaccaccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502710482626255tcaacacaactgtttaatagtacttgggataggcctgaagggacaaatatcactgaaggaaatgacaatatcacactcccatacagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagagggcaaattagatgttcatcaaatattacaggtataatgttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502810482626249tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtaataccacgaacgagaccaccgagatcttcggacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17502910482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagctggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacgcaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503010482626252tcaacacaactgtttaatagtacttgggataatcctgaagggacaaatatcactgaaggaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacaggtataatgttggcaagagatggtggtaataccacgaacgcgaccaccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503110482626249tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacaggtataatgttaacaagagatggtggtaataccacgaacgcgaccaccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503210482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactgcagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503310482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503410482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503510482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503610482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503710482626251tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacagattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattgatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503810482626252tcaacacaactgtttaatagtacttggaatggtactaaagagacaacaaacaacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagacgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17503910482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504010482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504110482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtgatattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504210482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504310482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504410482626252tcaacacaactgtttaatagtacttggaatggtgctgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtgatattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504510482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggaggt
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504610482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattatgaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504710482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtatcagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504810482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17504910482626251caacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtgatattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505010482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505110482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505210482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgagggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagagatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505310482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505410482626251caacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggccttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505510482626251caacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcagaaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505610482626252tcaacacaactgtttaatagtacttggaatggtactaaagagacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505710482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactgcagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505810482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaacaacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17505910482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17506010482626252tcaacacaactgtttaatagtacttgggataatccagaagtgttaaataacactgaaggaaatggcacaaccacactaccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagtcgttcatcaaatattacaggtataatgttaacaagagatggtggtaataccacgaacgagaccaccgagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17506110482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcagtgtatgcccctcccatcaggggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17506210482626252tcaacacaactgtttaatagtacttgggataatggtgaagtgttaagtaacactgaaggaaatggcacaaccacactaccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagttgttcatcaaatattacaggtataatgttaacaggagatggtggtaataccacgaacgagaccaccgagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17506310482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17506410482626252tcaacacagctgtttaatagtacttgggataatcctgaagggacaaatatcactgaaggaaatgacaatatcacacttccatgcagaataaaacaaattataaacatgtggctggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagttgttcatcaaatactacaggtataatgttaacaagagatggtggtaatagcacgaacgagaccaccgagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17506510482626252tcaacacaactgtttaatagtacttgggataatcctgaagggacaaatgtcactgaaggaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagttgttcatcaaatattacaggtataatgttaacaagagatggtggtaatagcacgaatgagaccaccgagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17506610482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcagtgtatgcccctcccatcaggggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17506710482626255tcaacacagctgtttaatagtacttgggataatcctgaagggacaaatatcactgaaggaaatgacaatatcacacttccatgcagaataaaacaaattataaacatgtggctggaagtaggaaaagcaatgtatgcccctcccatcaggggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)Lymph NodeTat (gp160)B (#) #AF17506810482626250tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcagtgtatgcccctcccatcaggggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggaggtattaacacaagagacaacaagacagagatcttcagacctggaggag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17506910482626255tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgcatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507010482626255tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatggggggattaacacaggcgacaacaagacagaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507110482626255tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatggtgggattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507210482626245tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagact
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507310482626255tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507410482626255tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507510482626252tcaacacaactgtttaatagtacttggaatgatactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacagattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507610482626252tcaacacaactgtttaatagtacttggaatgatactgaagggacgacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatctttagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507710482626252tcaacacaactgtttaatagtacttggaatgatactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggggga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507810482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcctctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17507910482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508010482626252tcaacacaactgtttaatagtacttggaatgatactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagacggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508110482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508210482626252tcaacacaactgtttaatagtacttggaatgatactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508310482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaagcaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508410482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508510482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508610482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508710482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508810482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagcaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatttcaacaagagatggtggtattagcaagagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17508910482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509010482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaagagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509110482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaagagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509210482626261tcaacacaactgtttaatagtacttgggatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509310482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccgtcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattagcaaaagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509410482626261tcaacacaactgtttaatagtacttggaatgatactgatattaaaaagttaaataacactgaaggaaatggcaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagcaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatttcaacaagagatggtggtattagcaagagcaacaacgattccgaggtcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509510482626225tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaac
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509610482626255tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509710482626255tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509810482626106tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaatagcactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaaca
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17509910482626205ttaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggg
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510010482626255ttaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcgcactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510110482626206tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacgaattagatgttcatcaaatattacagggatgatattaacaagagatggggg
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510210482626255tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaggcgacaacgagacagaggtcttcagacctgtaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510310482626218tcaacacaactgtttaatagtacttggaatggtactgaagtgttaaataacactgaaagaaatgacaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgccccacccatcagaggacaaattagatgttcatcaaatattacagggatgatattaacaagagatgggggcattaacacaga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510410482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggaggaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtttatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510510482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagggacaacaagacagagatcttcagacttggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510610482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacacttccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510710482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510810482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17510910482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511010482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511110482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaagcaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtttatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511210482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaaggcagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511310482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511410482626237tcaacgcaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttagaggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511510482626241tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511610482626250tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511710482626250tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcagcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaaggcagagatcttcagacctggaggag
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511810482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggaggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17511910482626252tcaacacaactgtttaatagtacttggaatggtactgaagggacgacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17512010482626243ctgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatattacagggacgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17512110482626230tgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttacagggatgattttaacaagagatggtggtattaacacaagagacaaaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17512210482626231tgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttacagggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
NA234HIVEUnknown SexIV Drug UserUnknown Viral Load30 cells / ulZDV128Unknown Patient Health1999United Kingdom (unknown)BrainTat (gp160)B (#) #AF17512310482626242tgtttaatagtacttggaatggtactgaagggacaacaaataacactggagaaaatatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcagcaaatattaccgggatgattttaacaagagatggtggtattaacacaagagacaacaagacagagatcttcagacctggaggagga
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Bone Marrowgp160 (Rev)B (B) (No)AF217150108717682665taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttgacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgatactatggggaatgctactaataccaatagtactagccagaatgctactaataccaataatactagctgggaagagatggagaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatggaatcaggccagtagtatcaactcaactgctgttaaatggtagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaactataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagagcaaaatggaatgaaactttaaaacaggtagttgacaaattaggaaagcaatttaagaataaaacaaagatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaaggatgaaggtaaagagaacgataccgagaccttcagaccacaaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggacacgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacagatttaatatataacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttcacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagcaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Bone Marrowgp160 (Rev)B (B) (No)AF217151108717682665taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgatactatggggaatgctactaataccaatagtactagccagaatgctactaataccaataatactagctgggaagagatggagaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatggaatcaggccagtagtatcaactcaactgctgttaaatggtagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaactataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagagcaaaatggaatgaaactttaaaacaggtagttgacaaattaggaaagcaatttaagaataaaacaaagatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaaggatgaaggtaaagagaacgataccgagaccttcagaccacaaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggacacgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacagatttaatatataacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttcacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Bone Marrowgp160 (Rev)B (B) (No)AF217152108717682665taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagagaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgatactatggggaatgctactaataccaatagtactagccagaatgctactaataccaataatactagctgggaagagatggagaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttggtgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatggaatcaggccagtagtatcaactcaactgctgttaaatggtagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaactataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggaaagcattatatacaacaggagccataataggagatataagaaaagcgtattgtaacattagtagagcaaaatggaatgaaactttaaaacaggtagttgacaaattaggaaagcaatttaagaataaaacaaagatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaaggatgaaggtaaagagaacgataccgagaccttcagaccacaaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggacacgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacagatttaatatataacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttcacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatcccctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Choroid Plexusgp160 (Rev)B (#) *AF217153108717682644taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctagaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtctattatgaggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttaggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaatgccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaataaataatgatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaggataagaacttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatagaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccaaggagagcattttatacaacaggagacataataagagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaggaataaaacaatacagtttcagccatcctcaggaagagacccagaaattgtaacacacagtctgaattgtggaggggaatttttctactgtaatacaacacacctgtttaatagtaattggactactattaatggtactacttggaatagtactgaaaggtcaaataacactgtaagaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccaggaggaggaaatatgaaggacaattagagaagtgaattatataaatataaagtagtacaaattgaaccattaagagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtaggaataggagctgtgttccttaggttcttaggagcagcaggaagcactataggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatctgctgaaggctattgaggcgcaacagcatctgttgcaactcacagtctaaggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctaggaatttgaggttgctctagaaagctcatctgcaccactactgtgccttagaatgctagttggagtaataaatccctagatatgatttagaataacatgacctggatggagtaggaaaaagaaattggcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattagataaatgggcaagtttgtagaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtagaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggagggaactaaagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataaggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaaaggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Choroid Plexusgp160 (Rev)B (#) *AF217154108717682644taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctagaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtctattatgaggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttaggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaatgccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaataaataatgatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaggataagaacttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatagaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccaaggagagcattttatacaacaggagacataataagagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaggaataaaacaatacagtttcagccatcctcaggaagagacccagaaattgtaacacacagtctgaattgtggaggggaatttttctactgtaatacaacacacctgtttaatagtaattggactactattaatggtactacttggaatagtactgaaaggtcaaataacactgtaagaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccaggaggaggaaatatgaaggacaattagagaagtgaattatataaatataaagtagtacaaattgaaccattaagagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtaggaataggagctgtgttccttaggttcttaggagcagcaggaagcactataggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatctgctgaaggctattgaggcgcaacagcatctgttgcaactcacagtctaaggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctaggaatttgaggttgctctagaaagctcatctgcaccactactgtgccttagaatgctagttggagtaataaatccctagatatgatttagaataacatgacctggatggagtaggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattagataaatgggcaagtttgtagaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtagaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggagggaactaaagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataaggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaaaggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Choroid Plexusgp160 (Rev)B (B) (No)AF217155108717682644taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctagaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtctattatgaggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttagaccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaatgccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaataaataatgatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaggataagaacttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatagaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccaaggagagcattttatacaacaggagacataataagagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaggaataaaacaatacagtttcagccatcctcaggaagagacccagaaattgtaacacacagtctgaattgtggaggggaatttttctactgtaatacaacacacctgtttaatagtaattggactactattaatggtactacttggaatagtactgaaaggtcaaataacactgtaagaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccaggaggaggaaatatgaaggacaattagagaagtgaattatataaatataaagtagtacaaattgaaccattaagagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtaggaataggagctgtgttccttaggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaacgatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggaatgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaactggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217156108717682647taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcgttacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatgctcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaatcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcctgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217157108717682647taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgcgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaagtcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217158108717682647taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaggacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaatcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217159108717682647taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccaccctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaatcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagagggaacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217160108717682647taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgtcgaggaatgctactaataccactagtgctagcaggaatgttactcataccaatagtactagctgggaagagatggagagaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatgtgcacttttttataaacttgatgtagtaccaatagaagataatgataataccagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgcacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaaatagttaaaaaattaagaggacaatttggaaataaaacaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctattgtaattcaacaccactgtttaatagtaattggactgggaatggtactacttggaatagtcctaaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctgctattaacaagagatggtggtagcaacagcagtaccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaatcagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagagtggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217161108717682635taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagtttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctgttgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtagtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217162108717682635taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagaacctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagtttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217163108717682635taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagcttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggctcgaaggaatcgcagaagaaggtggagagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217164108717682635taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccagcccacaagaagtagacttgaaaaatgtggcagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagtttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Braingp160 (Rev)B (B) (No)AF217165108717682634taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactaatagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaagattaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagaagagagtgataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacaaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattacttgtacaagacccaacaacaatacaagaaagagtatacatataggaccagggagagcattatatacaacaggagacataataggaaatataagacaagcatattgtaaccttagtagaacacaatggaataaagctttagagcaggtagttataaaattaggagaacaatttgggaataaaacaatacagtttcagtcatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaactcaacaccactgtttaatagtaattggactgggaatggtactacttggaatattatggaagagtcaaataacactgcaggaaatgacacaatcatactcacatgcagaataaaacaaattatcaacatgtggcaggaagtaggaaaagcaatgtatgcccctcccattagaggacaaattagatgtgaatcaaatattacagggctgctattaacaagagatggtggtaccaagaataacaataccgagaataacaatactgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccactaaggcaaaaagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcatttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggggagagaaacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Lymph Nodegp160 (Rev)B (B) (No)AF217166108717682650taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagagttattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattctgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaagaataacatggtagaacaaatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcaccgatgctaataccactagtactggcaagaatgttactaataccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacacacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataaggataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagacctcctttgaaccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaacttcaatggatcaggaccatgtgcaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccagggagagcattctatacaacaggagacataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaagaataaaacaaaaatagtttttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtgggggggaatttttctattgtaattcaacaccactgtttaatagtaattggactactattaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcctatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacaataaccaaacaggtaacgataccaccgagaccttcagaccgggaggaggaaatatgagggataattggagaagtgaattatataagtataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagtgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttcacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacgggcccgaaggaatcgcagaagaaggtggagagagagacaaagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Lymph Nodegp160 (Rev)B (B) (No)AF217167108717682617taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccctgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtatattatggggtacctgtgtggaaagaagcaactaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataattagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggagaggaatgctactaatatcactagtagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtacaaatagataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaaaaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaataatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggaaaacaatttaagaataaaacaaagatagcttttcagccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcagggagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgagatcttcagaccgggaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtgggacgatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatacgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatccggacaattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaactattacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Lymph Nodegp160 (Rev)B (B) (No)AF217168108717682614taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctacagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagactaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaataccactagtagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtacaaatagataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctgaagtgtaaagataagaatttcaatggaaaaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcgactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaataatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggagaacaatttgggaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaattcttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcagggagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaggtgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgagatcttcagaccgggaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaggaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagaactaaagaatagtgctgttagcttgctcaatgccacagctatcgcagtagctgaagggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Lymph Nodegp160 (Rev)B (#) *AF217169108717682614taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttaagatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtatattatggggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttaggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtaacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataattagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggagaggaatgctactaatatcactagtagtggcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagggataaggtacagaaagaatatgcacttttttataaacttgatgtagtacaaatagataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaaaaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaataatacaagaaaaggcatacatataggaccagggagagcattttatacaacagaagacataataggagacataagacaagcatattgtaaccttagtagaacacaatagaataaaactttagaacaggtagttataaaattaggagaacaatttaagaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgagaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcagggagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacaaggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgagatcttcagaccaggaggaggaaatatgaaggataattagagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtaggaataggagctgtgttccttaggttcttaagagcagcaggaagcactataggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagagctattgaggcgcaacagcatctgttgcaactcacagtctagggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctaggaatttaaggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctagatatgatttagaataacatgacctagatggagtaggaaaaagaaattagcaattacacaaatgtaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattggataaatgggcaagtttgtagaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaagaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaataaagttaggcagagatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagaccaggacgattagtagatggattcttagcacttatctaggacgacctgcggagcctgtgcctcttcagctaccaccgcttgaaagacttactcttgattgtaacgaggattgtggaacttctaggacgcagaaggtaagaaatcctcaaatattggtggaatctcctgcagtattgggggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgagaggacagataaggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaaaggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Lunggp160 (Rev)B (B) (No)AF217170108717682614taatagaaagagcagaagacagtggtaatgagagtgaaggagatcaggaagaactattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcagagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggagaggaatgctactaatatcactattagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtacaaatagataatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaatttcaatggaaaaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggagaacaatttgggaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggagggggatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcatactcacatgcagaataaaacaaattataaacatgtggcagggagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagagtaacaataccgaggtcttcagaccgggaggaggaaatatgagggataattggagaagtgaattgtataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattgttgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctagatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatgtaatatacaacttaattgaagaatcgcagaaccaacaagaaaaaaatgaacatgaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaaccgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctgcagtattggaggaaggaactaaagaatagtgctgttagcttgctcaatgccacagccatcgcagtagctgaggggacagatagggttatagaagtagtacaaagaatttatagagctattctccacatacctagaagaataagacagggcttagaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Lunggp160 (Rev)B (B) (No)AF217171108717682650taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtatggaaagaagcaactaccaccctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtatgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaacaacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaatatcactagcactaccactcctagcactacccctagtactggctggggaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataatacaagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgaaccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatacaacaggagacataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaggtagttggaaaattaggagaacaatttaagaatacaacaaagatagcttttcagccatcctcaggaggggacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccactgtttaatagtaattggactaggaataataatacttggaataatactggagagtcaaatcacactgaagacacaatcagtctctcatgcaggataaaacaaattataaacagatggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggttactattaacaagagatggtggtaacaataacaataccggtaacaacaccgagaccttcagaccgggaggaggaaatatgaaggacaattggagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaagctcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccggccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataggattatagaactagtacaaagaatttatagagctattctccacatacctagaagaataagacagggtttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Lunggp160 (Rev)B (B) (No)AF217172108717682650taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtatggaaagaagcaactaccaccctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtatgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaacaacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaatatcactagcactaccactcctagcactacccctagtactggctggggaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataatacaagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgaaccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatacaacaggagacataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaggtagttggaaaattaggagaacaatttaagaatacaacaaagatagcttttcagccatcctcaggaggggacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccactgtttaatagtaattggactaggaataataatacttggaataatactggagagtcaaatcacactgaagacacaatcagtctctcatgcaggataaaacaaattataaacagatggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggttactattaacaagagatggtggtaacaataacaataccggtaacaacaccgagaccttcagaccgggaggaggaaatatgaaggacaattggagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaagctcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaatcggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagcccagaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaaggaactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataggattatagaactagtacaaagaatttatagagctattctccacatacctagaagaataagacagggtttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Lunggp160 (Rev)B (B) (No)AF217173108717682650taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtatggaaagaagcaactaccaccctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtatgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaacaacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggtgaggaatgctactaatatcactagcactaccactcctagcactacccctagtactggctggggaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataatacaagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgaaccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgaggtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatacaacaggagacataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaaactttaaaacaggtagttggaaaattaggagaacaatttaagaatacaacaaagatagcttttcagccatcctcaggaggggacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacaccactgtttaatagtaattggactaggaataataatacttggaataatactggagagtcaaatcacactgaagacacaatcagtctctcatgcaggataaaacaaattataaacagatggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgtgtatcaaatattacagggttactattaacaagagatggtggtaacaataacaataccggtaacaacaccgagaccttcagaccgggaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtgctttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccggccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaaatcctcaaatattggtggaatctcctgcagtattggaggaagggactacagaatagtgctgttagcttgcttaatgccacagccatcgcagtagctgaggggacagataggattatagaactagtacaaagaatttatagagctattctccacatacctagaagaataagacagggtttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Meningesgp160 (Rev)B (B) (No)AF217174108717682526taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtatattatggggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtaacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataattagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtgaagaggaatgctactaatactagtagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataagactagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggagaacaatttgggaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccggggggaggaaatatgaaggacaattggagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattgttgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattagataaatgggcaagtttgtagaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaagtattggtggaatctcctgcagtattgggggaaggaactaaagaatagtgctgttagcttgcttaatgccacagctatcgcagtagctgaggggacagatagggttatagaactgttacaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Meningesgp160 (Rev)B (B) (No)AF217175108717682616taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggagagggggcaccttgctccttgggagttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtatattatggggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagacttgaaaaatgtaacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataattagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgtggagaggaatgctactaatactagtagtagcgagaaaacaatggacaaaggagaaataaaaaactgctctttcaatatcaccacaaacttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataagaataagactagatataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagatagaaatttcaatggaacaggaccatgtacaaatgtcagtacagtacaatgtacacatggaattgggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagatgatgtagtaattaggtctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaggtatacatataggaccagggagagcattttatacaacaggagacataataggagacataagacaagcatattgtaaccttagtagaacacaatggaataaaactttagaacaggtagttataaaattaggagaacaatttgggaataaaacaataaagtttcaaccatcctcaggaggagacccagaaattgtaacacacactcttaattgtggaggggaatttttctactgtaattcaacaccattgtttaatagtatttggaatattactgggaatattactgaagagtcaaataacactaaaggaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccggggggaggaaatatgaaggacaattggagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattgttgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttccatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaagggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcaattatctgggacgacctgcggggcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaagtattggtggaatctcctgcagtattgggggaaggaactaaagaatagtgctgttagcttgcttaatgccacagctatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Meningesgp160 (Rev)B (B) (No)AF217176108717682644taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaagggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtaggtcacagtctattatgaggtacctgtgtggaaagaagcaactaccactctattctgtgcatcagatgctaaagcatatgatacagaagcgcataatgtttaggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattgaaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacaaatgcatgaggatataatcagtttataggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaatgccaatagtactatcgaggaaaagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaataaataatgatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaggataagaacttcaatggatcaggaccatgtacaaatgtcagcacagtacaatgcacacatagaattaggccagtagtatcagctcaactgctgttaaatggcagtctagcagaagatgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccaaggagagcattttatacaacaggagacataataagagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttaggaataaaacaatacagtttcagccatcctcaggaagagacccagaaattgtaacacacagtctgaattgtggaggggaatttttctactgtaatacaacacacctgtttaatagtaattggactactattaatggtactacttggaatagtactgaaaggtcaaataacactgtaagaaatgacacaatcagactctcatgcagaataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctcccatcagaggacaaattaaatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccgagaataacaataccgaggtcttcagaccaggaggaggaaatatgagggacaattagagaagtgaattatataaatataaagtagtacaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtgttccttgggttcttaggagcagcaggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattgttgtctggtatagtgcaacagcagagcaatctgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacacatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacatgaattattggaattggataaatgggcaagtttgtggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagtaggtggcttagtaggtttaagaataatttttgctgtactttccatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccacgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcaattatctggggcgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaagtattggtggaatctcctgcagtattgggggaaggaactaaagaatagtgctgttagcttgcttaatgccacagctatcgcagtagctgaggggacagatagggttatagaactgttacaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataagatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Bloodgp160 (Rev)B (B) (No)AF217177108717682641taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaggcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaataccaatagtactatcgaggaagagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaacttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttgggaataaaacaatacagtttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacacacctgtttaatagtaattggactgggaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacacaatcagactctcatgcaggataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctccaatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccggtaacgataccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcgggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcagcagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagagctaaagaatagtgctgttagcttgctcaataccacggccatcgcagtagctgaggggacagatagggttatagaactattgcaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataaaatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Bloodgp160 (Rev)B (B) (No)AF217178108717682641taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaggcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaataccaatagtactatcgaggaagagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaacttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttgggaataaaacaatacagtttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacacacctgtttaatagtaattggactgggaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacacaatcagactctcatgcaggataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctccaatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccggtaacgataccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcgggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcagcagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatgaagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagagctaaagaatagtgctgttagcttgctcaataccacggccatcgcagtagctgaggggacagatagggttatagaactattgcaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataaaatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)Bloodgp160 (Rev)B (B) (No)AF217179108717682641taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaggcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacggaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccactagtactggcaagaatgttactaataccaatagtactatcgaggaagagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaacttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttgggaataaaacaatacagtttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacacacctgtttaatagtaattggactgggaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacataatcagactctcatgcaggataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctccaatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccggtaacgataccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcgggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcagcagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagagctaaagaatagtgctgttagcttgctcaataccacggccatcgcagtagctgaggggacagatagggttatagaactattgcaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataaaatgggtggcaagtggtcaaaa
546HADMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountAZT + ddI9660Deceased2000United States (unknown)PBMCgp160 (Rev)B (B) (No)AF217180108717682641taatagaaagagcagaagacagtggcaatgagagtgaaggagatcaggaagaattattggctctggaaatggggcaccttgctccttgggatgttaatgatctgtagtgctgcagaaaaatcgtgggtcacagtctattatggggtacctgtgtggaaagaggcaaccaccactctattttgtgcatcagatgctaaagcatatgatacagaagcacataatgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaagtagaattggaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgttactttaaattgcactgatgctaataccgctagtactggcaagaatgttactaataccaatagtactatcgaggaagagatggacaaaggagaaataaaaaactgctctttcaatatcaccacaactttaagagataaggtacagaaagaatatgcacttttttataaacttgatgtagtaccaatagataatgataatacaagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaagatctcttttgagccaattcccatacattattgtgccccggctggttttgcgattctaaagtgtaaagataagaacttcaatggaacaggaccatgtacaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgttaaatggcagtctagcagaagacgatgtagtaattagatctgaaaatttcacgaacaatgctaaaaccataatagtacagctgaaagaagctgtacaaattaattgtacaagacccaacaacaatacaagaagaagtataaatataggaccagggagagcattatatacaacaggagccataataggagatataagaaaagcatattgtaacattagtagaacaaaatggaatgaagctttaaaacaggtagttgaaaaattaggaaaacaatttgggaataaaacaatacagtttcagccatcctcaggaggagacccagaaattgtaacacacagtcttaattgtggaggggaatttttctactgtaattcaacacacctgtttaatagtaattggactgggaatggtactacttggaatagtactgaagggtcaaataacactgcaggaaatgacacaatcagactctcatgcaggataaaacaaattataaacaggtggcaggaagtaggaaaagcaatgtatgcccctccaatcagaggacaaattagatgtgtatcaaatattacagggctactattaacaagagatggtggtaacagtaacaataccggtaacgataccgaggtcttcagaccacaaggaggaaatatgagggataattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctgtattccttgggttcttaggagcagcgggaagcactatgggcgcagcgtcaataacgctgacggtacaggccagacaattattgtctggtatagtgcaacagcagagcaatttgctgagggctattgaggcgcagcagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaagggaccaacagctcctgggaatttggggttgctctggaaaactcatctgcaccactactgtgccttggaatgctagttggagtaataaatccctggatatgatttggaataacatgacctggatggagtgggaaaaagaaattagcaattacacaaatttaatatacaacttaattgaagaatcgcagaaccaacaagaaaagaatgaacaagaattattggaattggataaatgggcaagtttgtggaattggtttaacataacagaatggctgtggtatataaaaatattcataatgatagtaggaggcttagtaggtttaagaatagtttttgctgatctttctatagtgaatagagttaggcagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacaggcccgaaggaatcgcagaagaaggtggagagagagacagagacagatcaggacgattagtggatggattcttagcacttatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagacttactcttgattgtaacgaggattgtggaacttctgggacgcagggggtgggaagtcctcaaatattggtggaatctcctacagtattggaggacagagctaaagaatagtgctgttagcttgctcaataccacggccatcgcagtagctgaggggacagatagggttatagaactattgcaaagaatttatagagctattctccacatacctagaagaataagacagggcttggaaagggctttgctataaaatgggtggcaagtggtcaaaa
99No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status30AIDS2001Kenya (Nairobi)BrainTat (gp160)A (?/D/D/D/A1/A1) (No)AF364107113126581228tttaacatgtggaaaaatgacatggtagaacagatgcatacagatataatcagtctatgggatgaaagcttacaaccatgtgtgaaattaaccccactctgtgtcactttaaactgcactgacactactaatgtcaataactcagaaccaatgaaaaactgctctttcaatatgaccacagaactaagggataagaaacagaaagtacattcacttttttatagacttgatgtggtacaaatagatgataataatagttctaataccaactataccaactatagattaataaattgtaatacctcagtcattacacaggcttgcccagaggtatcctttgagccaattcccatacattattgtgccccagctggttttgcgatcctaaagtgtaaggatgagaagttcaatggaacagggccatgcaagaatgtcagcacagtacaatgctcacatggaatcaagccagtagtatcaactcaactgttgttgaatggtagtctagcagaaggagaggttaaaattagatctgaaaatatcacaaacaatggcaaaaatataatagtacaacttgtcaaccctgtgaaaattgagtgtatcagacctaacaacaatacaagaaaaggtacacgtataggaccagggcaaacactctttacaacaagcataatagggaatataagacaagcatattgtaatgtcagtaaatcagcatggaataacactttacaacaggtaggtaaacaattaggagagtactttaagaacaaaacaattagatttaatggctcctcgggaggggacatagaaattacaacacacagttttaattgtggaggagaatttttctattgtaatacatcaggtctgttcaatggctcttggaatgccaatgccagcaatgccagcatgcaggagtcaaatgacactataactctccaatgcagaataaaacaaattataaatatgtggcagagagcaggacaagcagtgtatgcccctcccatccaaggagtaataaggtgtgaatcagacattacaggactgatattaacaagagatggtggggacaataataatacaagtgaaatcttcagacctggaggaggagatatgagagacaattggagaagtgaattatataggtataaagtagtaaaaattgaaccgctaggagtagcacccaccagggcaaggagaagggtggggagagagaaaaaagagcagt
99No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status30AIDS2001Kenya (Nairobi)SpleenTat (gp160)A (A1/?/A1/A1) (No)AF364108113126581328ctactgtctgggctcacatgcctgtgtacccacagaccccgacccacaagaaatacatttggaaaatgtgacagaagagtttaacatgtggaaaaatgacatggtagaacagatgcatacagatataatcagtctatgggatgaaagcttaaagccatgtgtaaaattaaccccactctgtgtcactttaaactgcactgacactactaatgtcaataactcagaaccaatgaaaaactgctctttcaatatgaccacagaactaagggataagaaacagaaagtacattcacttttttatagacttgatgtggtacaaatagatgataataatagttctaataccaactataccaactatagattaataaattgtaatacctcagtcattacacaggcttgcccaaaggtatcctttgagccaattcccatacattattgtgccccagctggttttgcgatcctaaagtgtaaggatgagaagttcaatggaacagggccatgcaagaatgtcagcacagtacaatgcacacatgaaatcaagccagtagtatcaactcaactgttgttgaatggtagtctagcagaaggagaggtaaaaattagatctgaaaatatcacaaacaatggcaaaaatataatagtacaacttgtcaaccctgtgaaaattgagtgtatcagacctaccaacaatacaagaaaaggtatacgtataggaccagggcaaacactctttacaacaagcataataggggatataagacaagcacattgtaatgtcagtaaatcagcatggaataacacttcacaacaggtaggtaaacaattaggagagtactttaaaaacaaaacaattagatttgataactcctcgggaggggacatagaaattacaacacacagttttaattgtggaggagaatttttctattgtaatacatcaggtctgttcaatggctcttggaatgccaatgccagcaatgccagcatgcaggagtcaaatggcacggagtcaaatgacactataactctccaatgcagaataaaacaaattataaatatgtggcagagagcaggacaagcagtgtatgcccctcccatccaaggagtaataaggtgtgaatcaaacattacaggactaatattaacaagagatggtggggacaataagaatacaagtgaaaccttcagacctggaggaggagatatgagagacaattggagaagtgaattatataggtataaagtggtaaaaattgaaccactaggagtagcacccaccagggcaaggagaagagtggggagagagaaaaaagagcagttggaaa
104No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status37AIDS2001Kenya (Nairobi)BrainTat (gp160)B (B) (No)AF364109113126581347cacatgcttgtgtacccacagaccccaacccacaagaaatacatttggaaaatttgacagaagagtttaacatgaggaaaaataacatggtagagcagatgcatacagatataatcagtctatgggaccaaagtctaaagccatgtgtaaagttaacccctctctgcgttactctaaattgtaataatgtcaccagtagtagtaataatggcaccagtagtagtaataataccaccagtaatggcaccatcgaagacatacaagaaatgaaaaactgctctttcaatataaccacagaaataagggataagaaaaagaaagtatattcacttttttataggcttgatatagtacaacttaatgaaaatcagaataatagtaataatagtagtgagtatagattaataaattgtaatacctcagccattacacaagcttgtccaaaggtatcctttgagccaattcctatacattattgtgccccagctggttttgcgattctaaagtgtaaggataaggagttcaatggaacagggccatgcaagaatgtcagtacagtacaatgcacacatggaatcaagccagtagtatcaactcaactgctgttaaatggcagtctagcagaagggaaggtaatgattagatctgaaaatattacaaacaatgctaaaaatataatagtacaatttaacgagactgtgaaaattaattgtaccagacctaacaataatacaagaaaaagtatatctataggaccaggacaagcattctatgcaacaggtgacataataggggatataagacaagcacattgtagtgtcaatggatcagaaaataaagctttacaacaggtagttacacaattaagaacatactttaagaataaaacaataatattcactggctcctcaggaggggatccagaaataacaacacatagtttcaactgtggaggagaatttttctattgtaacacatcaggcctgtttaatagcacctggaatagcactgagtcaaatagcacggggtcaaatgacactataaatctcccatgcagaataaagcaaattataaatatgtggcagagagcaggacaagcaatatatgcccctcccacccaaggaataataatgtgtaaatcaaacattacaggactaatattaacaagagatggtggtgggaatggtaacagtacaaatgaaaccttcagacctggaggaggagatatgagggacaattggagaagtgaattatataagtataaagtagtaaaaaaaaaaccactaggaatagcacccaccaagtcaaagagaagagtggtggagagaaagaaaagggcggtagtta
104No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status37AIDS2001Kenya (Nairobi)SpleenTat (gp160)B (B) (No)AF364110113126581243acatggtagagcagatgcatacagatataatccatgtgtaaagttaacccctctctgcgttactctaaattgtaataatgtcaccagtagtagtaataatggcaccagtagtagtaataataccaccagtaatagcaccatcgaagacatacaagaaatgaaaaactgctctttcaatataaccacagaaataagggataagaaaaagaaagtatattcacttttttataggcttgatatagtacaacttaatgaaaatcagaataatagtaataatagtagtgagtatagattaataaattgtaatacctcagccattacacaagcttgtccaaaggtatcctttgagccaattcctatacattattgtgccccagctggttttgcgattctaaagtgtaaggataaggagttcaatggaacagggccatgcaagaatgtcagtacagtacaatgcacacatggaatcaagccagtagtatcaactcaactgctgttaaatggcagtctagcagaaggaaaggtaatgattagatctaaaaatattacaaacaatgctaaaaatataatagtacaatttaacgagactgtgaaaattaattgtaccagacctaacaataatacaagaaaaagtatatctataggaccaggacaagcattctatgcaacaggtgacataataggaaatataagacaagcacattgtaatgtcagtagatcagaatggaataaagctttacaacaggtagttacacaactaagaacatactttgggaataaaacaataatattcactggctcctcaggagggaatctagaaataacaacacatagttttaactgtggaggagaattattctattgtaacacatcaggcctgtttaatagcacctggaatagcactgagtcaaatagcacgggggcaaatggcactataaatctcccatgcagaataaagcaaattataaatatgtggcagagagcaggacaagcaatatatgcccctcccatccgaggagtaataatgtgtaaatcaaacattacaggactaatattaacaagagatggtggtgggaatggtagcagtacaaatgaaaccttcagacctggaagaggagatatgagggacaattggagaagtaaattatataagtataaagtagtaaaaattgaaccactaggaatagcacccaccaagtcaaagagaagagtggtggagagagagaaaagagcagtaggaata
118No HANDFUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status52AIDS2001Kenya (Nairobi)BrainTat (gp160)B (B) (No)AF364111113126581313cctacagaccccaacccacaagaaataaatttggaaaatgtgacagaagattttaacatgtggaaaaataacatggtagagcagatgcatacagatataatcagtttatgggaccaaggcttaaagccatgtgtaaagttaacccctctctgtgttactttaaattgcttccataatatcaccatcaatagcaccgcagatagcaggcaagaaataaaaaactgctctttcaatatgaccacagaattaagagataagagacagaaagtatattcacttttttatagcctagatgtagtacaacttgaaaataccagcagccagtatagattgataaattgtaatacctcagtcattacacaagcttgtccaaaggtatcctttgagccaattcccatacattattgtgccccagctggttttgcgattctaaagtgtaaggataaggatttcaatggaacaggaacatgcaagaatgtcagtacagtacaatgtacacatggaatcaagccagtagcatcaactcaactgctgttaaatggcagtctagcagaaggaaaggtaaggattagatctgaaaatctcacaaataatgccaaaaacataatagtacaacttaccaagcctgtaagaattaattgtaccagacctaccaacaatacaagaaaaagtgtacctataggaccaggacaagcattctatacaacagacataataggggatataagacaagcatattgtgagatcagtggagcagaatggaatgacactttgcaagaggtagccgaacaattaagacaatcccttgggggcaacataacaacaataatttttgctaatcccacaggaggggatctagaaataacaacacatagttttaattgtggaggagaatttttctattgtaacacatcaagactatttaatagcatttggcatggcaatgagacaaatagcacggagtcaaacaacacaaatagcatggagtcaaacagcactataactctccaatgcagaataaagcaaatcataagaatgtggcagagagtaggacaagcaatgtatgcccctcccatcccaggaagaataaggtgtgaatcaaacattacagggctaatattgataagagatgatgagggtaataacagaacaaatgaaaccttcagacctggaggagatatgagggacaattggagaagtgaattatataagtataaagtagtaaaaattgaaccactaggagtagcacccaccaaggcaaagagaagagtggggagagaggaaaaagagcagttggactgggagctgtcttc
118No HANDFUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status52AIDS2001Kenya (Nairobi)Spleen(gp120)B (B) (No)AF364112113126581191tttaacatgtggaaaaataacatggtagagcagatgcatacagatataatcagtttatgggaccaaagtctaaagccatgtgtaaagctaacccctctctgcgtgactttagattgctcccataatgtcactaccaccattagcaccgccaccagtaatgccacacaaaaaataaatagtgccactacagatgccagacaagaaataaaaaactgctctttcaatatgaccacagaattaagggataagaaacagagagtatattcacttttttatagcctagatgtagtacaacttgagaatgacaacagccagtatagattaataaattgtaatacctcagtcattacacaagcttgtccaaaggtatcctttgagccaattcccatacattattgtgccccagctggttttgcgattctaaagtgtaaggataaggatttcaatggaacaggaacatgcaagaatgtcagcacagtacaatgtacacatggaatcaagccagtagcatcaactcaactgctgttaaatggcagtctagcagaaggaaaggtaatgattagatctgaaaatctcacaaacaatgccaaaaacataatagtacaacttacccagcctgtaaaaattacttgtaccagacctaacaacaatacaataaaaagtgtacgtataggaccaggacaagcattctatgcaacaggtaaaatagtaggggatataagacaagcatattgtgatatcagtggagcagaatggaataacgctttgaaacaggtagccgaacaattaagaacatcccttgggggcaacaacacaaaaataatttttgctaattccacaggaggggatctagaaataacaacacatagttttaattgtggaggagaatttttctattgtaacacatcaagactatttaatagcacttggcatggcaatgagacaaatagcatggagtcaaacagcaatataactctccaatgcagaataaagcaaatcataagaatgtggcagagagtaggacaagcaatgtatgcccctcccatcccaggaagaataaggtgtgaatcaaacattacaggactaatattaacaagagatggtggggataataacagaacaaatgaaaccttcagacctggaggaggagatatgagggacaattggagaagtgaattatataagtataaa
58No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status35AIDS2001Kenya (Nairobi)BrainTat (gp160)B (B) (No)AF364113113126581525atgagagtgaaggggatacagaggaattggcaaaacttgtggagattgggaactatgatcttggggatgataataatttgtagtactgcagaaaacttgtgggttactgtctactatggggtacctgtgtggaaagacgcagagaccaccctattctgtgcatcagatgcgaaagcatatgatacagaagtgcataatgtctgggctacacatgcctgtgtgcctacagaccccgacccacgagaaataaatttggaaaatgtgacagaaaagtttaacatgtggaaaaataacatggtagagcagatgcatacagatataatcagtctatgggaccaaagcctaaagccatgtgtaaagttaacccctctctgcgttactttagagtgcaccagcatcagcaacaccacccataatatcaccaatgacatgagaggagagataaaaaactgctcttttcatatgaccacagaattaagggataggaaacggaaagtatattcacttttttatagaatagatgtagtaccacttaataccagcagcagccagtatagattaataaattgtaatacctcagccattacacaggcttgtccaaaggtaacctttgaaccaattcccatacattattgtgccccagctggttttgcgattctaaagtgtagggataagaagttcaatggaacagggccatgcacgaatgtcagcacagtacaatgcacacatggaatcaagccagtagtatcaactcaactgctgttaaatggcggtctagcagaaggaaagataatgatcagatctgaaaatatcacaaacaatgccaaaaacataatagtacaatttaccagccctgtaacaattaattgtaccagacctaacaataatacaagggaaagtgtacgtataggaccaggacaagcattctatgcaacgggtgacataatagggaaaatcagacaagcatattgtgaggtcaataaaacagaatggaatggagctttgaaagaggtagccagccaattaagcacatactttgagaacaaaacaataatttttgctaactccggaggggatctagaaataacaacacacagttttaattgtggaggagaatttttctattgtaacacatcaggcctgtttaatagcacttggcatagcaatgccagcaggccaaatgatacggagtcaaatggcaatataactctccaatgcagaataaagcaaattgtaaatatgtggcagagagcaggacaagcaatatatgcccctcccattccaggagtaataaggtgtgtatcaaacattacaggactaatattaacaagagatggtggggttaataacagtataaatgaaaccttcagacctggaggaggagatatgagggacaattggagaagtgaattatataagtataaagtagtaaaaatcgagccaataggagtagcacccaccagggcaaagagaagagtggtggagagagaaaaaagagcagttggaataggaggtgtctttcctg
58No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status35AIDS2001Kenya (Nairobi)Spleen(gp120)B (B) (No)AF364114113126581289ctgtctgggctacacatgcctgtgtgcctacagaccccaacccacaagaaataaatttggaaaatgtgacagaaaagtttaacatgtggaaaaataacatggtagagcagatgcatacagatataatcagtctatgggaccaaagcctaaagccatgtgtaaagttaacccctctctgcgttactttagagtgcaccaatatcatcaccaatactaatatcaccaatgacatgggagaagatataaaaaactgctcttttaatatgaccacagaattaagggataagaaacggaaagtatattcacttttttatagaatagatgtagtacaatttaataacagcagacaatatagattaataaattgtaatacctcagccattacacaagcttgtccaaaggtaacctttgaaccaattcccatacattattgtgccccagctggttttgcgattctaaagtgtaaggataaggagttcaatggaacagggctatgcaagaatgtcagcacagtacaatgcacacatggaatcaagccagtagtatcaactcaactgctgttaaatggcagtctagcagaagaaaagataatgatcagatctgaaaatatcacaaacaatgccaaaaacataatagtacaatttaccaggcctgtaacaattaattgtaccagacctaacaataatacaagaaaaagtgtacctataggaccaggacaagcattctatgcaacaggtgacataataggggatataagacaagcatattgtgaggtcaatagaacagaatggaataagactttgcaagaggtagccaaccaattaagaacatactttgggaacaaaacaatagtctttgctaactcctcaggaggggatctagaaataacaacacatagttttaattgtggaggagaatttttctattgtaacacatcaggcctgtttaatagcacttggaatggcaatgccagcatgccaaatggcacggagtcaaatgacactataactctccaatgcagaataaagcaaattataaatatgtggcagagagcaggacaagcaatatatgcccctcccatcccaggagtaataaggtgtgtatcaaacattacaggactaatattaacaagagatggtgggggtattaacagtacaaatgaaaccttcagacctggaggaggagatatgagggacaattggagaagtgaattatataagtataaagtagtaaaaattgaaccaataggagtagcacccaccaaggcaaagagaagagtggtggagaga
75No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status29AIDS2001Kenya (Nairobi)BrainTat (gp160)B (B) (No)AF364115113126581242gatgcatgaggatataatcagtttatgggatgaaagcctaaacccatgtgtaaaattaaccccactctgtgtcactttaaactgcactgaatgggagagtaaaaatgccactactgccaatgccactgttgtctctaatgccactggtaaggacctaggagtaaaaaactgctctttcgatgtaaccacagaaataagggataggaaaaagaaaatacatgcacttttttataaacttgatgtagtacccataaaggatgataggactaataccagctatagattaataaattgtaatacctcagccattacacaggcgtgtccaaaggtatcctttgagccaattcccatacattattgtgccccagctggatttgcaattctaaaatgtaacgataaagagttcaatgggacaggtccatgcaaaaacgtcagcacagtacagtgtacacatgggattaagccagtagtgtcaactcaactgttgttgaatggcagcctggcagaggaagagataataattaaatctgaaaatctcacaaataatgctaaaatcataatagtacagcttaaggagtctgtaacaattaattgcacaaggccctatagcaataaaagagaaggtacacatatgggaccaggacgagcactctatacaacaggagatatagtaggagatatcagacaggcaaattgtactattaatggagcagcatggaataaaactttacaacaggtagctgaaaaattaggagaccgtcttaatcagacaacaataatttttcaaccatcctcggggggggacccagaaattgtaacacacagctttaattgtggaggggaattcttctgctgcgatacatcaggactgtttaatagtacatggaagaatggtacatcagagagtatagtaaatgagactatcacactcccatgcagaataaaacaaattataaacatgtggcagggagtaggaaaagcgatgtatgcccctcccattgaaggactaattagatgttcatcaaatattacaggactgttgttggcaagagatggtggtgcaaataataatagtcagaatgagaccttcagacctggaggaggagatatgagagacaattggagaagtgaattatacaaatataaagtagtaagaattgaaccactaggtctagcacccaccaaggcaagaaggagagtggtggaaagagaaaaaagagcaataggactaggagctctgtt
75No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status29AIDS2001Kenya (Nairobi)SpleenTat (gp160)B (B) (No)AF364116113126581284taaacccatgtgtaaaattaaccccacttctgtgtcacttttaaactgcactgaatggaagggtgaaaatgccactactgccaatgccaccgctgcctctaaagccactggtaaggacctagaagtgaaggaatgctctttcgatataaccacagaaataagggataggaaaaagaaagtacaggcacttttttataaatctgatgtggtacaaatagatgatgataatagtactaataccagcaatagaactaatgatggtaatagtactaataccagccatagatcctatagattaatacattgtaatacctcaaccattacacaggcgtgtccaaaggtatcctttgagccaattcccatacattattgtgccccagctggatttgcaattctaaaatgtaacgagaagaatttcaatgggacaggtccatgcaacaatgtcagcacagtacagtgtacacatgggattaagccagtagtgtcaactcaactgttgttgaatggcagtctggcagaagaagagataataattagatctgaaaatctcacaaataatgctaaagtcataatagtacaacttaatgagtctatagcaattaatcgcacaaggccctatagcagtacaagaaaagatatacatgtgggacccagacaacgagcactcttttacaaaaaattagtaggaaatataaaacaagtacattgtaatattagtagagtagcatggaataaaactttacaacaggtagctaaaaaattaagagacctttttaatctgacaaaaataatctttaactcatcctcgggaggggacccagaaattacaacacacagctttaattgtggaggggaattcttctactgcaatacatcaggactgtttaatagtacatggaatagtacatgggagaattatagtacatcaaatagtacagtaaatgagaatatcacactcctatgcagaataagacaagttataaacacgtggcagggagtaggaaaagcaatgtatgcccctcccattgaaggaataattagatgttcatcaaatattgctggactattgttgacaagagatggtggtgcaagtaatggtagccggaatgaggcctgcagaaatgataccttcagacctggaggaggagatatgagagacaattggagaagtgaattatacaaatataaagtagtaagaattgaaccactaggactagcacccaccaaggcaagaaggagagtggtggaaagagaaaaaagagcaataggaggaggaggtcaatc
100No HANDFUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status40AIDS2001Kenya (Nairobi)BrainTat (gp160)B (B) (No)AF364117113126581355tttaaaacagcagcacataatgtctgggctacacatgcctgtgtaccaacagaccccgacccacaagaaataaaattagaaaatgtcacagaaaactttaacatgtggaaaaataacatggtggagcagatgcatgaggatataatcagtttatgggatgaaagcctaaaaccatgtgtaaaattaaccccactctgtgtcactttagactgcattgaatggaatgcgaatgccactaaaaataccactgtagatggcataggaatgaaaaactgctctttcaatataaccacagaaataagagataggaagaagcaagtacatgcacttttttataagcttgatgtagtaccaatacaggatgataagagtaataccagctatagattaataaattgtaatacctcagccattacacaggcgtgtccaaaggtatcctttgagccaattcccatacattattgtgccccagctggatttgcaattctaaaatgtaatgataagaagttcaatgggacgggtccatgcaaaaatgtcagcacagtacagtgcacacatgggattaaaccagtagtttcaactcaattgttgttgaatggcagtctagcagaagaagaaataataattagatctgaaaatcttgcaaataatgctaaaattataatagtacagcttaatgagtctgtaacaattaattgctcaaggccctacaacaacacaagacaaagtacgcatatgggaccaggacgagcactttacacaaacaatataataggagatataagacaagcatattgtaatgttagtggaacatggaataaaactttgcaacaggtagctaaacaattaggagagcttttcaacaagacaataataacttttcaaccaccctcaggaggggacccagagattacaacacatagctttaattgtggaggggaatttttctactgcaatacatcaggactgtttaacaatagttatgatacatctgacagtacatcaaacagtacaagggaaaatgggacagagccaatcaaaatcccatgcagaataaaacaaattataaacatgtggcaggaagtaggcaaagcaatgtatgcccctcccattgaaggactaatcagatgttcatcaaatattacaggactattgttgacaagagatggtggtaaaaataagaatggtcagaatgagaccttcaggcctgcaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaagaattgaaccactaggtctagctcctaccagagcaaagagaagagtggtggaaagagaaaaaagagcaataggactgggagctgtgtt
100No HANDFUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status40AIDS2001Kenya (Nairobi)SpleenTat (gp160)B (B) (No)AF364118113126581188caaatgcatgaggatgtaatcagtttatgggatgaaagcctaaaaccatgtgtaaaaataactccactctgtgtcactttaaactgcattgaatggaatgcgaccgccactaatataggaatgacaaactgctctttcaatataaccacagaggtaatagataagaagaaacaagaatatgcacttttttataaacttgatgtggtaccaatagagggtgataatagtaatactagctatagattaataaattgtaatgcctcagcccttacacaggcgtgtccaaaggtatcctttgagccaattcccatacattattgtgccccagctggttttgcaattctaaaatgtaatgataagaggttcaatgggacgggtccatgcaagaacgtcagcacagtacagtgcacacatgggattaagccagtagtctcaactcaattgttgttgaatggcagtctagcagaagaagagatgataattagatctgaaaatctcacaaataatgctaaaattataataatacagcttaatgagtctataacaattaattgctcaaggccctacaaaaggacaaaacacaaaacgcatataggaacaggacaagcactatatacaaagaggataggaggatatataagaccaccacattgtaacattagtggactaggatggaataaaactttacaacagatagctagacaattaggagatctttttaacaagacaacaataaaatttcaaccaccctcaggaggggacccagaaattacaacacacagctttaattgtggaggagaatttttctactgcaatacatcaaaactgtttaatactagttataatacatcagatagtagaagggtaaatgagacaaatgatgagacaatcagaatcccatgcaaaataaaacaaattataaacatgtggcagaaagtaggcaaagcaatgtatgcccctcccattgaagcagaaatcacatgttcatcaaatattacaggaatattgctgacaagagatggtggtgaaagtaatactagtcagagtgagaccttcaggcctgcaggaggagatatgagagacaattggagaagtgaattatacaaatataaagtagtaagaatagaaccactaggtctagcgcctaccagggcaaagagaagagtggggaaagagaaaaaagagcaa
108No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status31AIDS2001Kenya (Nairobi)BrainTat (gp160)B (B) (No)AF364119113126581251tttaacatgtggaaaaataacatggtggagcagatgcatgaggatataatcagtctatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgttactttaaactgcagtgaattgaagaatagcactaatggcactatggatgacataggaatgacaaattgctctttcaatatgactacagaagtaagagataggcagaagcgagtacaggcacttttttatagacttgatgtagtaccaatagataagaaggataataccagctatagattaataaattgtaatacctccaccattacacaggcatgtccaaaggtaaactttgagccaattcctatgcattattgtgccccagctggatttgcaattctaaaatgtaatgataagaaattcaatgggacgggtctatgcaaaaatgtcagcacagtacagtgtacacatgggattaagccagtagtgtcaactcaactgttgttgaatggaagtctagcagaagaagagataataattagatctgaaaatctcacaaataatgcaaaaattataatagtacagcttaatgagtcggtacaaattaattgtaccagacccaacaacaatacaagacaaggtatacacataggaccaggacaagctatatatacaaataaagctatatatacaaataacataataggagatataagacaagcacattgtaacattagtagaatacaatggaataaaaccttacaacaggtagctggaaaattaagagacctttttaacaaaacaacagtaatctttaaaccacccttgggaggagacccagagattacctcacacacctttaattgtggaggggaatttttttactgcaatacatcaggactgtttaataatagtgaatggacatcaagtagtagcgtaaattatagtacagggggaaatgagacaatcacactccgatgcagaataaaacaaattatcaacatgtggcagggagtaggaagagcaatgtatgcccctcccattgcaggacaaatcaattgttcatcaaatattacaggattattgttaacaagagatggtggtgaatataataatagtcaagacaatgagaccttcagacctggaggaggagatatgagagacaattggagaagtgaattatacaaatataaagtagtaagaattgaaccactaggtctagcacccaccaaggcaaagagaagagtggggaaagagaaaaaagagcaa
108No HANDMUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status31AIDS2001Kenya (Nairobi)SpleenTat (gp160)B (B) (No)AF364120113126581319cacatgcttgtgtaccaacagaccccaacccacaagaaataaaattagaaaatgtcacagaacactttaacatgtggaaaaataacatggtggagcagatgcatgaggatataatcagtctatgggatcaaagcctaacaccatgtgtaaaattaaccccactctgtgttactttaaactgcagtgaattgaataatagcactaatggcactatggatgacataggaatgacaaattgctctttcaatatgaccacagaagtaagagataggaagaagcaagtacaggcacttttttatagacttgatgtagtacagatagataagaaggataataccagctatagattaataaattgtaatacctccaccattacacaggcatgtccaaaggtaaactttgagccaattcccatacattattgtgccccagctggatttgcaattctaaaatgtaatgataagaaattcaatgggacgggtccatgcaaaaatgtcagcacagtacagtgtacacatgggattaagccagtagtgtcaactcaactgttgctgaatggcagtctagcagaagaagagataataattagatctgaaaatctcacaaataatgcaaaaattataatagtacagcttaatgagtcggtacaaattaattgtaccagacccaacaacaatacaagaaaaagtatacacatagtaccaggacaagctatatatgctcataaagctgtatatacaaagaacaacataataggagatataagacaagcacattgtaacattagtagaatgcaatggaataaaaccttacaacaggtagctgaaaaattaaaagacctttttaacaaaacaacagtaaattttaaaccatcctcgggaggggacctagaaattacctcacacacctttaattgtggaggggaatttttttactgcaatacatcaggactgtttaacaatagtgaatggacatcaaatagtagtgcagataatagtacagggggaaatgtgaatatcacgctccaatgcagaataaaacaaattatcaacatgtggcagggagtaggaagagcaatgtatgcccctcccattgcaggactaatcaagtgtacatcaaatattacaggattattgttaacaagagatggtggtgaatataataatagtcaagataatgagaccttcagacctggaggaggagatatgagagacaattggagaagtgaattatacaaatataaagtagtaagaattgaaccactaggtttagcacccaccaaggcaaagagaagagtggggaaagagaaaaaagagcaa
102No HANDFUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status42AIDS2001Kenya (Nairobi)BrainTat (gp160)B (B) (No)AF364121113126581312tatctttgaggcacataccgtctgggccacacatgcatgtgtcccaacagaccccaatccacaagagataatactaggaaatgtcacagaaaattttaacatgtggaaaaatcacatggtggagcagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgtcaccctgaactgcactgaagtgaaaaataatggaactgatggaaataaaactgaggacacaggaatgagaaactgctctttcaatgtaaccacagaattaagagataggacagagagagtagatgcacttttttacaagcttgatgtggtacaaataagtaatgataataccggctataggttaataaattgtaatacctcagccattacacaggcatgtccaaaggtaacctttgagccaattcccatacattattgtgccccagctggatttgcaattctaaaatgtaacgataagaggttcaatgggactggtccatgcaaaaatgtcagcacagtacagtgtacacatgggattaagccagtagtgtcaactcaattgttgttgaatggcagtttagcagaagaagacataataattaggtctgaagatttcgcaaataatgctaaaatcataatagtacagcttaatgagtctataacaattaattgcacaaggcccaacaacaatacaagacaaagtacacatataggaccaggacaagcactatttacaactaaaataataggagacataagacaagcatattgtaacattagtggaaaagcatggaatacaactttgcacaaggtagctaaaaaattaggagacctttttaacaagacaacaattatttttaaaccatcctcaggaggggacccagaaattacaacacacagctttaattgtggaggggaatttttcttctgcaatacatcaggactgtttaatagaacttataatacaacatattataatacaacaaatagtacagactcaatcatactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggcaaagcaatgtatgcccctcccattgcaggacaaatcaattgttcatcaaatattacaggactattgttaacaagagatggtggtaatataactagtcagaatgagacctttagacctggaggaggagatatgagagacaattggagaagtgaactatacaagtataaagtagtaagaatagaaccactaggtttagctcccaccagggcaaagagaagagtggggaaagagaaaaaagag
102No HANDFUnknown Risk FactorUnknown Viral LoadUnknown CD4 CountUnknown Therapy StatusUnknown Therapy Status42AIDS2001Kenya (Nairobi)Spleen(gp120)B (B) (No)AF364122113126581249ccttttgaatacctttggagcacatactgtctgggccacacatgcatgtgttccaacagaccccaacccacgagagataagactagaaaatgtcacagaaaactttaacatgtggaaaaatcacatggtggagcagatgcatgaggatataatcagtttatgggatcaaagcctaaaaccatgtgtaaaattaaccccactctgtgtcactttaaactgcactgaagtgataaataatggaactaataaagttgagggcacaggaatgagaaactgttctttcaatgtaaccacagaattaagagataagaaagagagagtagatgcacttttttataagcttgatgtggtacaaataggtaatgatagtaccagctataggttaataaattgtaatacctcagccattacacaggcatgtccaaaggtaacctttgagccaattcccatacattattgtgccccagctggatttgcaattctaaaatgtaatgataagaggttcaatgggactggtccatgcaaaaatgtcagcacagtacagtgtacacatgggattaagccagtagtgtcaactcaattgttgttgaatggcagtttagcagaagaagacataataattagatctgaaaatctcacaaataatgctaaaatcataatagtacagcttaatgagtctataacaattaattgcacaaggcccaacaacaatacaagacaaagtacgcatataggaccaggacaggcactatttacaactaatataataggagacataagacaagcatattgtaacattagtggaaaagcatggaatacaactttgcacagggtagctaaaaaattaggagacctttttaaggagacaacaatagttcttaaaccatcctcaggaggggacccagaaattacaacacacagctttaattgtggaggagaatttttcttctgcaatacatcaggactgtttaataagacttataatacatcagatgattatactgcattaaataatacagatccaatcacactcccatgcagaataaaacaaattataaacatgtggcaggaagtaggcaaagcaatgtatgcccctcccattacaggacaaatcaattgttcatcaaatattacaggactattgttaacaagagatggtggtgaaaatattaatagaactaatgagacctttagacctggaggaggagatatgagagacaattggagaagtgaattatacaaatataaa
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920011689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatgggataatactttaaaacagatagctatcaagttaagaaaacaatttaagaataaaacaatagac
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920111689650240ttcacgaacaatgctaaaatcataatagtacagctgaaggaagctgttaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataaggcaagcacactgtgaacttagtagaagaaaatgggataatactttaaaacagatagcaataaagttaagaaaacaatttaagaataaaacaatagac
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920211689650246ttcacgaacaatgctaaaatcataatagtacagctgaaggaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatattaggcaagcacattgtaaccttagtagaacaaaatggaataaaactttaaagcaggtagttataaagttaagagaacaatttgagaataaaacaatagac
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920311689650246ttcacgaacaatgctaaaaacataatagtacagctgaatgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacattgtgaacttagtagaacaaaatgggatagaactttaaaacagatagttaacaagttaagaaaacaatttaagaataaaacaatagac
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920411689650246ttcacgaacaatgctaaaatcataatagtacagctgaaggaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatggaataacactttaaaacagatagttaacaagttaagagaacaatttaagaataaaacaataatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920511689650246ttcacgaacaatgctaaaatcataatagtacagctgaaggaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatggaataacactttaaaacagatagttatcaagttaagaaaacaatttaggaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920611689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacattgtaaacttagtagaacaaaatgggataacactttaaaacagatagttatcaagttaagaaaacaatttaggaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920711689650246ttcacgaacaatgctaaaatcataatagtacagctgaaagaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagtgcattttatgcaacaggagacataataggagatataaggcaagcacactgtaaacttagtagaacaaaatgggataacactttaaaacagatagttaacaagttaagaaaacaatttaagaataaaacaataatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920811689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacattgtgaccttagtagaacaaaatggaataaaactttaaagcagatagctaacaagttaagaaaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40920911689650246ttcacgaacaatgctaaaatcataatagtacagctgaacgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagacataaggcaagcacactgtgatcttagtagaccaaattggaataaaactttaaaacaggtagttatgaagttaagaaaacaatttaagaataaaacaataatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40921011689650246ttcacgaacaatgctaaaatcagaatagtacagctgaaggaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataaggcaagcacactgtgaccttagtagaacaaaatggaataatactttaaaacagatagctaacaagttaagaaaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40921111689650246ttcacgaacaatgctaaaatcataatagcacagctgaaagaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagagcaaaatggaataaaactttaaaacaggtagttataaagttaagagaacaatttaagaataaaacaataatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40921211689650246ttcacgaacaatgctaaaagcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagtgcaatttatgcaacaggagacataataggagatataaggcaagcacactgtaaccttagtagaacaaaatgggataacactttaaaacagatagctataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40921311689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaagtataaatataggaccaggcagagcaatttatgcaacaggagacataataggagatatcagacaagcacattgtaaccttagtagaacaaaatgggatagaactttaaagcagatagctataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40921411689650246ttcacgaacaatgctaaaatcataatagtacagctgaaggaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagtgcaatttatgcaacaggagacataataggagacataagacaagcacactgtaaccttagtagaacaaaatgggataaaactttaaaacagatagatataaagttaaaagaacaatttaagaataaaacaataatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40921511689650246ttcacaaacaatgctaaaatcataacagtacagctgaaagaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatgggataaaactttaaaacaggtagctataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40921611689650246ttcacgaacaatgctaaaagcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaagtataaatataggaccaggcagagcaatttatacaacaggagacataataggagatataaggcaagcacactgtaaccttagtagaacaaaatgggataaaactttaaaaaaggtagctataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40921711689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatgggataaaactttaaaacaggtagctataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40921811689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatgggataaaactttaaaacaggtagctataaagttaagagaacaatttaagaataaaacaataatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40921911689650246ttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagagcaatttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatgggataaaactttaaaacaggtagctataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40922011689650246ttcacgaacaatgctaaaagcataatagtacagctgaaagaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataaggcaagcacactgtaaccttagtagaacaaaatgggataaaactttaaagcaggtagttaacaagttaagagaacaatttaagaataaaacaataatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40922111689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatgggataaaactttaaaacaggtagctataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40922211689650237ttcacagacaatgctaaaagcataatagtacagctgaagaaacctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtataagcaaatggaatcaaactttaaaacagatagttaaaaagttaaaagaacaatttaagaataaa
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40922311689650253ttcacagacaatgctaaaagcataatagtacagctgaaaaaacctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtataagcaaatggaatcatactttaaaacagatagttaaaaagttaaaagaacaatttaagaataaaacaatagtctttaatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40922411689650249ttcacagacaatgctaaaagcataatagtacagctgactaaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaagcaaatggaatgaaactttaaaacagatagttaaaaagttaaaagaacaatttaagaataaaacaatagtcttt
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40922511689650244ttcacagacaatgctaaaagcataatagtacagctgaagaaacctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtataagcaaatggaatcatactttaaaacagatagttaaaaagttaagagaacaatttaagaataaaacaatag
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40922611689650245ttcacagacaatgctaaaagcataatagtacagctgaataaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaacattagtaaaagagaatggaataaaactttaaaacagatagttaaaaagttaaaagaacaatttaagaataaaacaatagt
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40922711689650244ttcacagacaatgctaaaagcataatagtacagctgagtaaacctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtataagaaaatggaatcaaactttaaaacagatagttaaaaagttaaaagaacaatttaagaataaaacaatag
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40922811689650251ttcacagacaatgctaaaagcataatagtacagctgactaaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagtagcaaatggaatgaaactttaaaacagatagttataaagttaagagaacaatttaagaataaaacaatagtctttaa
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40922911689650251ttcacagacaatgctaaaagcataatagtacagctgaagaaacctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagtagcaaatggaataatactttaaaacagatagttaaaaagttaagagaacaatttaagaataaaacaatagtctttaa
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40923011689650251ttcacagacaatgctaaaagcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtataaatataggaccaggcagagcattttatacaacaggagagataataggagatataagacaagcacattgtaaccttagtagaagcaaatggaataatactttaaaacagatagttaataagttaagagaacaatttaagaataaaacaatagtctttaa
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40923111689650259ttcacagacaatgctaaaagcataatagtacagctgaaagaatctgtagaaattaattgtacaagacctaacaacaatacaagaaaaagtatacatataggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagaagcaaatggaataaaactttaaaacagatagcttataagttaagagaacaatttaagaataaaacaatagtctttaatcaatcct
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40923211689650259ttcacagacaatgctaaaagcataatagtacagctgagtaaacctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagagataataggagatataagacaagcacattgtaaccttagtagtagcaaatggaataatactttaaaacagatagcttataagttaagagaacaatttaagaataaaacaataatctttaatcaatcct
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40923311689650249ttcacagacaatgctaaaagcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaagtataaatataggaccaggcagagcattttatacaacaggagatataataggagatataagacaagcacactgtaaccttagtagtagcaaatggaatcatactttaaaacagatagctagcaagttaagagaacaatttaagaataaaacaataatcttt
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40923411689650259ttcacagacaatgctaaaagcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaagtataaatatagggccaggcagagcattttatacaacaggagagataataggagatataagacaagcacattgtaaccttagtagaagcaaatggaataacactttaaaacagataggttataagttaagagaacaatttaagaataaaacaatagtctttaatcaatcct
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40923511689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatgggataacactttaaaaaagatagttataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40923611689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatataggaccaggcagagcattttatacaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatgggataaaactttaaaacagatagttaacaagttaagaaaacaatttaagaataaaacaataatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40923711689650246ttcacgaacaatgctaaaaacataatagtacagctgaataaacctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtacaagcaaatggaatgaaactttaaaacagataggatataagttaagaaaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40923811689650246ttcacgaacaatgctaaaaacataatagtacagctgaatgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacattgtaatcttagtagaacaaaatgggataaaactttaaaacagatagctataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40923911689650246ttcacgaacaatgctaaaaacataatagtacagctgaataaacctgtagaaattaattgtacaagacccagcaacaatacaagaaaaggtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaagcaaatggaatgaaactttaaaacagataggatataagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40924011689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatgggatgaaactttaaaaaagatagttcaaaagttaagaaaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40924111689650246ttcacggacaatgctaaaagcataatagtacagctgaataaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaagtataaatatagggccaggcagagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcaaaatggaatagcactttaaaaaagatagttataaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40924211689650246ttcacgaaccatgctaaaagcataatagtacagctgaatgaatctgtagaaattaattgtacaagacccagcaacaatacaagaaaaagtataaatataggaccaggcagagcattttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcaaaatggaataacactttaaaacagatagctagtaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40924311689650246ttcacgaacaatgctaaaatcataatagtacagctgaatgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatagcaccaggcagtgcattttatgcaacaggagacataataggagatataagacaagcacactgtaaccttagtagaacaaaatggaataacactttaaaaaagatagttaaaaagttaagagaacaatttaagaataaaacaatagtc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40924411689650246ttcacgaacaatgctaaaatcataatagtacagctgaaagaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagtgcattttatgcaacaggagacataataggagacataaggcaagcacactgtaaccttagtagaacaaaatggaataacactttaaaacagatagttacaaagttaagagaacaatttagaaataaaacaataatc
NA246HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40924511689650246ttcacgaacaatgctaaaatcataatagtacagctgaaggaagctgtagaaattcattgtacaagacccagcaacaatacaagaaaaagtataaatataggaccaggcagagcaatttatacaacaggagacataataggagatataagacaagcacattgtaaccttagtagaacaaaatgggataaaactttaaagcaggtagctataaagttaagagaacaatttaggaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40924611689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcactttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtagagcaaaatgggagaaccctttaaaaaagatagttataaaattaggagaacaatttgggaagaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40924711689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcactttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtagagcaaaatgggagaaccctttaaaaaagatagttatcaaattaggagaacaatttgggaagaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40924811689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcactttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtagagcaaaatgggagaaccctttaaaaaagatagttaaaaaattaggagaacaatttgggaagaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40924911689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcactttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtagagcaaaatgggagaaccctttaaaaaagatagttataaaattgggagaacaatttgagaagaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40925011689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcactttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtagagcaaaatgggagaaccctttaaaaaagatagttataaaattaggagaacaatttgagaagaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40925111689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcactttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtagagcaaaatgggagaaccctttaaaaaagatagttatcaaattaggagaacaatttgggaagaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40925211689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcactttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtagagcaaattggaagaacactttaaaaaagatagttataaaattaggagagcaatttgggaagaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40925311689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcactttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtagagcaaattggaagaaccctttaaaaaagatagttataaaattaggagagcaatttgggaagaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40925411689650249ttcacgaacaatgctaaaattataatagtacagttgaatgaatctatagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatacaacaggacaaatagtaggagatataagacaagcacattgtaaccttagtagtgcaaaatggaacaacactttaaaaaagatagttataaagttaagagaacaatttgggaagaacaaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40925511689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcattttatacaacaggacaaataataggagatataagacaagcacattgtaacattagtagtgcaaaatggaataacactttaaaaaagatagttataaagttaagagaacaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40925611689650249ttcacgaacaatgctaaaatcatactagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcattttatacaacaggacaaataataggagatataagacaagcacattgtaaccttagtagtgcaaattggaataacactttaaaaaagatagttctaaagttaggagagcaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40925711689650249ttcacgaacaatgctaaaataataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcattttatacaacaggacagatagtaggagatataagacaagcacactgtaaccttagtaatgcaaattgggagaacactttaaaaaagatagttgtaaagttaggagagcaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40925811689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcattttatacaacaggacaaataataggagatataagacaagcacattgtaaccttagtagtgcaaattggaataacactttaaaaaagatagttataaagttaagagagcaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40925911689650249ttcacgaacagtgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcatttaatacaacaggacaaatagtaggagatataagacaagcacattgtaaccttagtagtgcaaaatggaataacactttaaaaaagatagttataaagttaggagagcaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40926011689650249ttcacaaacaatgctaacatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcaatttatacaacaggacaaataataggagatataagacaagaacactgtaaccttagtagtgcaaaatgggataacactttaaaaaagatagttataaagttaagagaacaatttgggaagaataaaacaatagtc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40926111689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaatcaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcattttatacaacaggacaaatagtaggagatataagacaagcacattgtaaccttagtagtgcaaaatgggagaacactttaaaaaagatagttataaagttaagagaacaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40926211689650249ttcacaaacaatgctaaaagcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcattttatacaacaggacaaataataggagatataagacaagcacattgtaaccttagtagtgcaaaatgggataacactttaaaaaagatagttataaagttaagagaacaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40926311689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcattttatacaacaggacaaataataggagatataagacaagcacattgtaaccttagtagtgcaagatggaataacactttaaaaaagatagttataaagttaagagaacaatttgggaagaataaaacaatgatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40926411689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtgaagcaaaatgggagaacactttaaaaaagatagttataaaattaggagaacaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40926511689650249ttcacgaacaatgctaaaaccataatagtacagttgaatgaagctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtgaagcaaaatgggagaacactttaaaaaagatagttataaaattaggagaacaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40926611689650249ttcacaaacaatgctaaaatcataataatacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacactgtaaccttagtgaagcaaaatgggagaacactttaaaaaagatagttataaaattaggagaacaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40926711689650249ttcacaaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgcacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtgaagcaaaatgggagaacactttaaaaaagatagttataaagttaagagaacaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40926811689650246ttcacaaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtgaagcaaaatgggagaacactttaaaaaagatagttataaaactaggagagcaatttaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40926911689650249ttcacgaacaatgctaaaaccataatagtacagttgaatgaacctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtgaagcaaaatgggagaacactttaaaaaagatagttataaagttaggagagcaatttaagaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40927011689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtgaagcaaaatgggagaacactttaaaaaagatagttataaaattaggagaacaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40927111689650249ttcacaaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgcacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtgaagcaaaatgggagaacactttaaaaaagatagttataaagttaagagaacaatttgggaagaataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40927211689650249ttcacggacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtagtgcaaaatgggagaaccctttaaaaaagatagttataaggttaagagaccaatttgggaataataaaacaataatc
NA420HIVEUnknown SexIV Drug UserUnknown Viral Load7 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40927311689650249ttcacgaacaatgctaaaatcataatagtacagttgaatgaatctgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacatttaggaccaggcagagcattttatacaacaggagaaataacaggagatataagacaagcacattgtaaccttagtgaagcaaaatgggagaaccctttaaaaaagatagttatcaagttaggagaacaatttgggaagaataaaacaataatc
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40927411689650231atcacgaacaatgctaaaaccataatagtacaactgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagaaataataggagatattagacaagcacattgtaacattagtagagcagaatggaatagcactttaagacaggtagctaaaaagttaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40927511689650231atcacgaacaatgctaaaaccataatagtacaactgacaaaagctgtaaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggaggaataataggagatattagacaagcacattgtaacattagtagagcagaatggaatagcactttaagacaggtagctaaaaagttaagcgaacaatttgga
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40927611689650231ttcacaaacaatgctaaaaccataatagtacagctgacaaaggctataagaattaactgtacaagacccaacaataatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatattagacaagcacattgtaacattagtagagcagattggaatagccctttaagaccggtagctaaaaagttaagaaaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40927711689650231atcacgaacaatgttaaaaccataatagtacaactgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagaaattataggagatattagaccagcacattgtaacattaggagagcagattggaatagccctttaagacatgtagctaacaagttaagcgaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40927811689650231atcacgaacaatgttaaaaccataatagtacaactgacaaaagctataaaaattaactgtacaagactcaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagaaataataggagatattagaccagcacattgtaacattagaagagcagattggaataacactttaagaccgatagctgacaagttaagagaacaatttgga
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40927911689650231atcacgaacaatgttaaaaccataatagtacaactgacaaaagctataagaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagaaattataggagatataagaccagcacattgtaacattagtagagcagaatggaatagcactttaaaacagatagctgacaagttaagagaacaatttgga
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40928011689650231atcacgaacaatgctaaaaccataatagtacaactgaaagcagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagaaattataggagatataagaccagcacattgtaacattagtagagcagaatggaatagcactttaaaacagatagctgacaagttaagcgaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40928111689650231atcacgaacaatgctaaaaccataatagtacaactgaaagcagctataaaaattaactgtacaagactcaacaacaatacaagaaaaactatacatataggaccagggagagcattttatgcaacaggagaaataataggagatataagacaagcacattgtaacattagtagaacagaatggaatagcactttaaaacagatagttgacaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40928211689650231atcacgaacaatgttaaaaccataatagtacaactgacaaaagctataagaattaactgtacaagactcaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagaaataataggagatataagacaagcacattgtaacattagtagagcagaatggaatagcactttaaaacagatagctgacaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40928311689650231atcacgaacaatgttaaaaccataatagtacaactgacaaaagctataagaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagaaataataggagatataagacaagcacattgtaacattagtaaagcagattggaataacactttaaaacagatagctgacaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40928411689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaggctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtaaagtagattggaatagcactttaaaacatgtagctgacaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40928511689650231ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaataatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtagagtagattggaatagcactttaaaacagatagttgacaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40928611689650231ttcacgaacaatgctaagaccataatagtacagctgacaaaggctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagagtagattggaatagcactttaaaacagatagctgacaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40928711689650231ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagattggaatagcactttaagacaggtagctgaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40928811689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtaaagtagaatggaataacactttaagacaggtagctgaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40928911689650231ttcacaaacaatgctaaaaccataatagtacagttgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtagagtagattggaatagccctttaaaacaggtagctgaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40929011689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagattggaatagcactttaaaacaggtagctgaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40929111689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtaaagtagaatggaataacactttaagacaggtagctgaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40929211689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaggtagctgaaaaattaagagaacaatatggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40929311689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagagtagaatggaatagcactttaaaacaggtagctgaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40929411689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaggtagctgaaaaattaagagaacaatatggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40929511689650231ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaagtagctgaaaaattaaaaaaacaatatggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40929611689650242ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaggtagctgaaaaattaagagaacaatttgggataataacaat
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40929711689650242ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaacaatacaggaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaggtagctgaaaaattaagagaacaatatgggaacaaaacaat
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40929811689650231ttcacaaacaatgctaagaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtaaagtagaatggaatgacactttaaaacagatagctgaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40929911689650231ttcacgaacaatgctaaaaccataatagtacagttgacaaaagctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaggtagctgaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930011689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacgagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaagtagctgaaaaattaagagaacaatatggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930111689650231ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaggtagctgaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930211689650231ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaacaacacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagatagatggaatagcactttaaaacaggtagctaaaaaattaagagaacaatatggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930311689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatgacactttaaaacaagtagctgaaaaattaagagaacaatatggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930411689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaataatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtaaagtagaatggaataacactttaaaacaagtagctcaaaaattaagagaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930511689650231ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtaaagtagaatggaataacactttaaaacaagtagctgaaaaattaagagaacaatatggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930611689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaagtagctgaaaaattaagagaacaatatggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930711689650231ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaaaacccaacaacaatacaagaaaaagtatacatataggaccagggaaagcattttatgcaacaggaaatataataaaagatataaaacaagcacattgtaacattagtaaagtaaactggaatagcactttaaaacaagtagctaaaaaattaaaaaaacaatttggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930811689650231ttcacgaacaatgctaaaaccataatagtacagctgacaaaagctataaagattaactgtacaagacccaacaacaatacaagaaaaagtatacctataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtaaagtagaatggaatagcactttaaaacaagtagctgaaaaattaagagaacaatatggg
NA118HIVEUnknown SexIV Drug UserUnknown Viral Load56 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40930911689650231ttcacaaacaatgctaaaaccataatagtacagctgacaaaagctataaaaattaactgtacaagacccaacaacaatacaagaaaaagtatacatataggaccagggagagcattttatgcaacaggagatataataggagatataagacaagcacattgtaatattagtaaagtagaatggaatagcactttaaaacaagtagctgaaaaattaagagaacaatatggg
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931011689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcactttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931111689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaaggatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931211689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaagaatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931311689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaagaatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931411689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcgacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931511689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaaggatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931611689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931711689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaaggatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931811689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaaggatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40931911689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaggtcataatagtacagctgaatgaaacggtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaagtggaatgacactttacaaagaatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40932011689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagtaattaattgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaagtggaatgacactttacaaaggatagttataaagttagaagaacaatttaagaataaaacaatagtctttgatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40932111689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaagaatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40932211689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcagtttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40932311689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcagtttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40932411689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcagtttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40932511689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcagtttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40932611689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcagtttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40932711689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcagtttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40932811689650300ctagcagaagaaggggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcagtttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40932911689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtataagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcattttatgcaacaggaaacataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaagataagtataaagttagaagaacaatttaagaataaaacaatattctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40933011689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaagaatagctataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40933111689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtataagacccaacaacaatacaagaaaaggtataaatataggaccaggcagagcattttatgcaacaggaaacataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaagataagtataaagttagaagaacaatttaagaataaaacaatagtctttgatcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40933211689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtacaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagttataaagttaagagaacaatttaagaataaaacaatagcctttaagcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40933311689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagtcaagcaaaatggaatgaaactttaaaaaggatagttataaagttaagagaacaatttaagaataaaacaatagcctttaagcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40933411689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagtcaagcaaaatggaatgaaactttaaaaaggatagttataaagttaagagaacaatttaagaataaaacaatagcctttaagcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40933511689650300ctagcagaagaagaggtagtaattaaatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtacaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttaaaaaggatagttataaagttaagagaacaatttaagaataaaacaatagcctttaagcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40933611689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaagaatagttataaagttaagagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40933711689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagtcaagcaaaatggaatgaaactttacaaaggatagttataaagttaagagaacaatttaagaataaaacaatagccttcaagcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40933811689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagtcaagcaaaatggaatgaaactttaaaaaggatagttataaagttagaagaacaatttaagaataaaacaatagcctttaagcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40933911689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgaaactttaaaaaggatagttataaagttagaagaacaatttaagaataaaacaatagccttcaagcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40934011689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaagaatagttataaagttagaagaacaatttaagaataaaacaatagcctttaagcaatcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40934111689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggaagaataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgacactttacaaagaatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaaccctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40934211689650300ctagcagaagaagaggtagtaattagatccaaaaatttctcgaacaatgctaaagtcataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaggtatacatataggaccaggcagagcattttatgcaacaggagccataataggagatataagacaagcacattgtaaccttagccaagcaaaatggaatgaaactttaaaaaggatagttataaagttagaagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40934311689650300ctagcagaagaagaggtagtaattagatctgaaaacttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacccataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcccattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40934411689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40934511689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaactgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcccattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40934611689650300ctagcagaagaagaggtagtaattagatctgaaaacttcacgaacaatgttaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacccataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40934711689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcccattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40934811689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcccattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40934911689650300ctagcagaagaagaggtagtaattagatctgaaaacttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacccataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40935011689650300ctagcagaagaagaggtagtaattagatctgaaaacttcacgaacaatgttaaaagcataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacccataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40935111689650300ctagcagaagaagaggtagtaattagatctaaaaatttcacaaacaatgctaaaagcataatagtacagctaaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttaagcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40935211689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcccattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40935311689650297ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaagtctaaaagcataatagtacagctaaatgaatctgtagcaattaattgtacaagaccccactacaaaacaagaacacgtatacctataggaccaggcacatcattttatacaacaggggcaaaaataggagatataagacaagtatattgtaacatcagtagagcaaaatggaatatcactttaagacggatagttacaaagttaagagaacaatttaataaaacaatagtctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40935411689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcccattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40935511689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaagtctaaaagcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaacagaatggaataacactttaaaaaagatagttataaagttaaaagaacaatttaataataaaacaatagtctttaatcaatcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40935611689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcccattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40935711689650300ctagcagaagaagaggtagtaattagatctgaaaacttcacgaacaatgttaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacccataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttaatcaatcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40935811689650300ctagcagaagaagaggtagtaattagatctgaaaacttcacgaacaatgttaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacccataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40935911689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcccattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40936011689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaataatgctaaaagcataatagtacagctgaatgaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttagtcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40936111689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaagcataatagtacagctgaatgaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcacactgtaacattagtggaacagaatggaataacaccttaagaaagatagttataaagttaaaagaacaatttaataataaaacaatagtctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40936211689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacaaacaatgctaaaagcataatagtacagctgaatgaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaacagaatggaataacactttaagaaggatagttataaagttaaaagaacaatttaataataaaacaatagtctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40936311689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40936411689650300ctagcagaagaagaggtagtaattagatctgaaaacttcacgaacaatgttaaaaacataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacccataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40936511689650300ctagcagaagaagaggtagtaattagatctgaaaacttcacgaacaatgctaaaaacataatagtacagctgaaggaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagacataataggagatataagacaagcacattgtaacattagtgaaacaaaatggaataacactttaagaaagatagttataaagttaaaagaacaatttaataataaaacaatagtctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40936611689650300ctagcagaagaagaggtagtaattatagccgaaaatttcacgaacaatgcgaaaagcataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaataatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggggaaataataggaaacataagacaagcacattgtaacattagtggaataagatggaataacactttaagacagatagctagaaagttaagagaacaatttgagaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40936711689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaagcataatagtacagctgaaggaatctgtaacaattaattgtacaagacccaacaataatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcccattgtaacattagtggaataaaatggaataacactttaagacagataggtagaaagttaagagaacaatttgggaataaaacaataatctttgatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40936811689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaaagcataatagtacagttgaatgaatctgtaacaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagacataataggagatataagacaagcacattgtaacattagtgaaacaaaatggaataacactttaagaaagatagttataaagttaaaagaacaatttaataataaaacaatagtctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40936911689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaagcataatagtacagctgaaggaatctgtaacaattaagtgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgagaataaaacaataatctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40937011689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaatctgtagtaattaattgtataagacccaacaacaatacaagaaaaagtatacctataggaccaggcagggcatggtatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaacaaaatggaataacactttaaaaaaggtagttataaagttaaaagaacaatttaataataaaacaatagtttttaatcgctcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40937111689650294ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaagcataatagtacagctaaatgaatctgtaacaattaattgtacaagacccaactacaatgcaataaaacgtatacctataggaccaggcacatcattttatacaacagggcaaatagtagatataagacaagcacattgtaacatcagtagagcaaaatggaatatcactttaagacggatagttacaaaattaaaagaaaactttaataaaacaatagtctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40937211689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaagcataatagtacagctgaatgaatctgtaacaattaattgtataagacccaacaacaatacaagaaaaagtatacctataggaccaggcaaagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtgaaataaaatggaataacactttaagacagatagttataaagttaaaagaacaatttaataataaaacaataatttttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40937311689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaagcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaataatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggggaaataataggaaatataagacaagcacattgtaacattagtggaataaaatggaataacactttaagacagatagttagaaagttaagagaacaatttgggaataaaacaataatctttgatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40937411689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaagcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaccaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaacagaatggaataacactttaaaaaagatagttataaagttaagagaacaatttaataataaaacaatagtctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40937511689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaaagcataatagtacagttgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagacataataggagatataagacaagcacattgtaacattagtgaaacaaaatggaataacactttaagaaagatagttataaagttaaaagaacaatttaataataaaacaatagtctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40937611689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaaagcataatagtacagttgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagacataataggagatataagacaagcacattgtaacattagtgaaataaaatggaataacactttaagcaagatagttataaagttaaaagaacaatttaataataaaacaataatttttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40937711689650294ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaagcataatagtacagctaaatgaatctgtaacaattaattgtacaagacccaactacaatgcaataaaacgtatacctataggaccaggcacatcattttatacaacagggcaaatagtagatataagacaagcacattgtaacatcagtagagcaaaatggaatatcactttaagacggatagttacaaaattaaaagaaaaatttaataaaacaatagtctttaatcactcctcagga
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40937811689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaagcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaccaatacaagaaaaagtatacctataggaccaggcagagcatggtatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaacagaatggaataacactttaaaaaagatagttataaagttaaaagaacaatttaataataaaacaatagtctttaatcactcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40937911689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938011689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938111689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938211689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938311689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938411689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaatgaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938511689650300ctagcagaagaagaggtagtagttagatccgccaatttcacaaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938611689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaacctgagtagaacaaaatggaataacactttaaaacagatagttataaagttaagagagcaatttgagaataaaacaataatcttgaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938711689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaggcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938811689650300ctagcagaagaagaggtagtagttagatctgccgatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagtaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40938911689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacacttttaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40939011689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaaaagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40939111689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacacttttaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40939211689650300ctagcagaagaagaggtagtagttagatctgccgatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagtaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40939311689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaggcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40939411689650300ctagcagaagaagaggtagtaagtagatccgccaatttcaaggacaatgctaaaaacataatagtacagctgactaaatctgtagaaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagtcataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40939511689650300ctagcagaagaagaggtagtaagtagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40939611689650300ctagcagaagaagaggtagtaagtagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatgcaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40939711689650300ctagcagaagaagaggtagtaagtagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40939811689650300ctagcagaagaagaggtagtaagtagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40939911689650300ctagcagaagaagaggtagtagttagatccgccaatttcaaggacaatgctaaaaacataatagtacagctgactaaatctgtagaaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagctataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940011689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940111689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagtacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940211689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940311689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940411689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940511689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940611689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaatataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940711689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940811689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40940911689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941011689650300ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagttgactaaacctgtaataattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatttttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941111689650300ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagctgactaaacctgtaataattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941211689650300ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagttgactaaacctgtaataattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941311689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941411689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941511689650300ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941611689650300ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagctgactaaacctgtaataattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941711689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgttttaattaattgtacaagacctagcaacaatacaataaaaggtatacatataagaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941811689650300ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagttgactaaacctgtaataattaattgtacaagacctagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40941911689650300ctagcagaagaagaggtagtaattagatccgtcaatttcacggacaatgctaaaaacataatagtacagctgactaaacctgtaataattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggaaaaataataggagatataagacaagcacattgtaaccttagtagaataaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40942011689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtattaattaattgtacaagacccagcaacaatacaataaaaggtatacacatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttaagaacaaaacaataatctttaatcaatcctcagga
NA38HIVEUnknown SexIV Drug UserUnknown Viral Load3 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40942111689650300ctagcagaagaagaggtagtagttagatccgccaatttcacgaacaatgctaaaaacataatagtacagctgactaaacctgtaataattaattgtacaagacccagcaacaatacaataaaaggtatacatatgggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagaacaaattggaataacactttaaaacagatagttataaagttaagagaacaatttgaaaataaaacaataatctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40942211689650300ctagcagaagaagagatagtaattagatctgaaaatttcacaaacaatgctaaagtaataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40942311689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40942411689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40942511689650300ctagcagaagaagaggtagtaattagatctgaaaattttacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtggaacaaaatggaataccactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40942611689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40942711689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtaataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggagatataagacaagctcattgtaacattagtggaacaaaatggaataccactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40942811689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataataatacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40942911689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtaataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggagatataagacaagctcattgtaacattagtggaacaaaatggaataccaccttaaagcgaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40943011689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtccacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtggaacaaaatggaataccactttaaaaagaattgctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40943111689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggagcacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtatttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40943211689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40943311689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagatataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40943411689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40943511689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagcatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40943611689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaagagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40943711689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40943811689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40943911689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944011689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944111689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944211689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944311689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944411689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagaaataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA199Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load28 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944511689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagtcataatagtacagctgaatgaaactgtacacattaattgtacaagacccaacaacaatacaagaagaagtatacatataggaccaggcagagcattttatgcaacaggagacataataggaaatataagacaagcacattgtaacattagtggaacacaatggaataacactttaaaaagaatagctataaagttaagagaacaatttaaaaataaaacaatagtctttaatcaatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944611689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagtaaaagggtaactctaggaccagggaaagtatggtatacaacaggagacatagtaggagatataagacaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttgggaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944711689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttgggaatagaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944811689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagaacaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttgggaatagaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40944911689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggagagcattttatacaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggactgagactctacaacagatagttataaaattaagagaacaatttgggaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40945011689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggagagcattttatacaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggactgagactctacaacagatagttataaaattaagagagcaatttggaaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40945111689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacgagaagaagtatacctataggaccagggaaagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcaaaatggaatgagactccacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40945211689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagaaaaagggtaactctaggaccagggagagtatggtatacaacaggagacatggtaggagatataagagaagcacattgtaaccttagtagagcaaaatggaatgacactctacaacaggtagttataaaattaagagaacaatttgggtataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40945311689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaagaccataatagtacagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggagagcattttatacaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggactgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40945411689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacgatacaagaagaagtatacctataggaccagggaaagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40945511689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatactaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagtaaaagggtaactctaggaccggggaaagtatggtatacaacaggagacatagtaggagatataagacaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttgggaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40945611689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagtaaaagggtaactctaggaccagggaaagtatggtatacaacaggagacatagtaggagatataagacaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttgggaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40945711689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggagagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttgggaatagaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40945811689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacaactgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatataggaccagggagagcattttatacaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40945911689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacaactgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatataggaccagggagagcattttatacaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtcttcaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946011689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaaaaaggataactctaggaccagggagagtatggtatacaacaggagacatagtaggagatataaggcaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946111689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagaaaaagggtaactctaggaccagggagagtatggtatacaacaggagacatagtaggagatataagagaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtcttcaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946211689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaaagagtataaatataggaccagggagagcattttatacaacaggagacataataggagatataagagaagcacattgtagccttagtagagcaaaatggagtgagactctacaacaggtagttataaaattaagagaacaatttgggaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946311689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctgtaggaccagggagagcattttatacaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946411689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtgcagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggagagcattttatacaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaagatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtcttcaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946511689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggagagcattttatacaacaggggacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtcttcaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946611689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggggagcattttatacaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtcttcaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946711689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacagctgaaggagtcggtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggaaagcattttatgcaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtcttcaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946811689650300ctagcagaagaagaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtacaactgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatataggaccagggagagcattttatacaacaggagacataataggagatataagagaagcacattgtaaccttagtagagcaaaatggaatgagactctacaacagatagttataaaattaagagaacaatttggaaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40946911689650300ctagcagaagaagaggtagtaattagatctgacaatttctcaggcaatgctaaaaccataatagtacagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaagaagtatacctataggaccagggaaagcattttatgcaacaggagacataataggagatataagacaagcacattgtaaccttagtagagcaaaatggaatgagactctaaaacagatagttataaaattaagagaacaatttggaaataaaacaatagtctttaattcatcctcagga
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40947011689650300ctagcagaagaggaggtagtaattagatctgacaatttctcagacaatgctaaaaccataatagtgcagctgaaggagtcagtagaaattaattgtacaagacccaacaacaatacaagaaaaaggataactctagggccagggagagcatggtatacaacaggagacatagtaggagatataaggcaagcacattgtaaccttagtagagcaaaatggaatgagaccctacaacaggtagttataaaattaagagaacaatttaagaataaaacaatagtctttaagtcatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40947111689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtagtaattaattgtattagatccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaaacatagtctttaatcaaccctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40947211689650297ctagcagaagaagagatagtaattagatcagaaaatttcacaaacaatgctaaaaccataatagtacagctaaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagacataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40947311689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtagtaattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40947411689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatactaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40947511689650297ctagcagaagaagaggtagtaattagatcagaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtagcattagtagcacacaatggaataaaactttaaaaggggtagttagaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40947611689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacagtgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40947711689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40947811689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagagaaaggataactacgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40947911689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaataggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40948011689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtagtaattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40948111689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaaggaaaaggataactatgggaccagacagagtatattatacaacaggagaaataataggagatataagaaaaacacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtttttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40948211689650297ctagcagaagaagaggtagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagacataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40948311689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgagtgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagaaagaataggagatataagaaaagcacattgtaacattagtagcacactatggaataaaacattaaaagggatagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40948411689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtagtaattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagacataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggcagttaaaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40948511689650297ctagcagaagaagaggtagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagacataataggagatataagaaaagcacactgtaacattagtagcacacagtggaataaaactttaaaaggggtagttagaaaattaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40948611689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtagtaattaattgtatgagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagacataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttagaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40948711689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctagaaccataatagtacagctgaatgaatctgtagtaattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagacataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaaggggtagttagaaagttaagagaacaatttaataaaacaatagtctttaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40948811689650297ctagcagaagaagagatagtaatcagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctaaatgaagctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatgggataaagctttaaaagggatagttagaaagttaagagaacaatttaataaaacaatagtctttactcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40948911689650297ctagcagaagaagaggtagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaaggataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaagggatagttagaaagttaagagaacaatttaataaaacaatagtcttcaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40949011689650297ctagcagaagaagaggtagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaatctgtaataattaattgtataagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatggaataaaactttaaaagggatagttagaaagttaagagaacaatttaataaaacaatagtcttcaatcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40949111689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaacctgtaataattaattgtacaagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatgggataaagctttaaaagggatagttagaaagttaagagagcaatttaataaaacaatagtctttactcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40949211689650297ctagcagaagaagagatagtaattagatccgaaaatttcgcaaacaatgctaaaaccataatagtacagctgactgaacctgtaataattaattgtacaagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatgggataaagctttaaaagggatagttagaaagttaagagagcaatttaataaaacaatagtctttactcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40949311689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaacctgtaataattaattgtacaagacccaacaacaatacaagaaaaagcataactatggggccaggcagagtatattgtacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatgggataaagctttaaaagggatagttagaaagttaagagagcaatttaataaaacaatagtctttactcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40949411689650297ctagcagaagaagggatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaacctgtaataattaattgtacaagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatgggataaagctttaaaagggatagttagaaagttaagagagcaatttaataaaacaatagtctttactcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40949511689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaacctgtaataattaattgtacaagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagaaataataggaggtataagaaaagcacattgtaacattagtagcacacaatgggataaagctttaaaagggatagttagaaagttaagagagcaatttaataaaacgatagtctttactcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40949611689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaacctgtaataattaattgtacaagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatgggataaagctttaaaagggatagttagaaagttaagagagcaatttaataaaacaatagtctttactcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40949711689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctaaaaccataatagtacagctgaatgaacctgtaataattaattgtacaagacccaacagcaatacaagaaaaagcataactatgggaccaggcagagtatattatataacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatgggataaagctttaaaagggatagttagaaagttaagagagcaatttaataaaacaatagtctttactcaatcctcagga
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (#) #AF40949811689650297ctagcagaagaagagatagtaattagatccgaaaatttcacaaacaatgctagaaccataatagtacagctgaatgaacctgtaataattaattgtacaagacccaacaacaatacaagaaaaagcataactatgggaccaggcagagtatattatacaacaggagaaataataggagatataagaaaagcacattgtaacattagtagcacacaatgggataaagctttaaaagggatagttagaaagttaagagagcaatttaataaaacaacagtctttactcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40949911689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaaacataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagtgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagggaacaatttaagaataaaacaatagcctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950011689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaaaggaacaatttaagaataaaacaatagtctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950111689650300ctagcagaagaagaggtagtgattagatccagcaatttctcggacaatactaaaatcatgatagtacagctgaataaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagagcattttttacaacaggagaaataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950211689650300ctagcagaagaagaggtagtaattagatccagcaatttctcggacaatactaaaatcataatagtacagctgaatgaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcattgtatacaacaggagacataataggagatataagaaaagcacattgtaacattagtggaacaaaatggaatgacactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950311689650300ctagcagaagaagaggtagtaattagatccagcaatttctcggacaatactaaaatcataatagtacagctgaatgaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcattgtatacaacaggagacataataggagatataagaaaagcacattgtaacattagtggaacaaaatggaatgacactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950411689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtgaaacacaatggaataccactttaagaaggatagttacaaagttaagggaacaatttaagaataaaacaatagtctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950511689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaagaaggatagttacaaagttaagggaacaatttaagaataaaacaatagtctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950611689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaagaaggatagttacaaagttaaaggaacaatttaagaataaaacaatagtctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950711689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaagaaggatagttacaaagttaagggaacaatttaagaataaaacaatagtctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950811689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaagaaggatagttacaaagttaagggaacaatttaagaataaaacaatagtctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40950911689650300ctagcagaagaagaggtagtgattagatccagcaatttctcggacaatactaaaatcatgatagtacagctgaataaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagagcattttttacaacaggagaaataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951011689650300ctagcagaagaagaggtagtaattagatccagcaatttctcggacaatactaaaatcataatagtacagctgaatgaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcattgtatacaacaggggacataataggagatataagaaaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951111689650300ctagcagaagaagaggtaataattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaagaaggatagttacaaagttaagggaacaatttatgaataaaacaatagtctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951211689650300ctagcagaagaagaggtagtaattagatccagcaatttctcggacaatactaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagagcattttttacaacaggagaaataataggagatataagaaaagcacattgtaacattagtggaacaaaatggaataacactttaagatggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951311689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttttacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagcacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951411689650300ctagcagaagaagaggtaataattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaagaaggatagttacaaagttaagggaacaatttaagaataaaacaatagtctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951511689650300ctagcagaagaagaggtagtaattagatccagcaatttctcggacaatactaaaatcataatagtacagctgaatgaatctatagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcattttttacaacaggagacataataggagatataagaaaagcacattgtaacattagtagaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951611689650300ctagcagaagaagaggtagtaattagatccagcaatttctcggacaatactaaaatcataatagtacagctgaatgaatctataataattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcattttatacaacaggagacataataggagatataagaaaagcacattgtaacattagtggaacaaaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951711689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaagaaggatagttacaaagttaagggaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951811689650300ctagcagaagaagaggtagtaattagatccagcaatttctcggacaatactaaaatcataatagtacagctgaatgaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtatacctataggaccaggcagagcattgtatacaacaggagacataacaggagatataagaaaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40951911689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagggaacaatttaagaataaaacaatagtctttaagcaaccctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40952011689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttttacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagcacaatttaagaatagaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40952111689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtaataattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcagagcaatttatacaacaggagacataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40952211689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaataatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40952311689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaataaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40952411689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40952511689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40952611689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40952711689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggatcaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40952811689650300ctagcagaagaagaggtagtaattagatccagcaatttctcaaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40952911689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40953011689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40953111689650300ctagcagaagaagaggtagtaatcagatccagcaatttctcgaacaatgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcggagcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacacaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA446HIVEUnknown SexIV Drug UserUnknown Viral Load137 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40953211689650300ctagcagaagaagaggtagtaattagatccagcaatttctcgaacaacgctaaaatcataatagtacagctgaatgaatctgtagcaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatgggaccaggcagcgcaatttatacaacaggagccataataggagatataagacaagcacattgtaacattagtggaacaaaatggaataccactttaaaaaggatagttacaaagttaagagaacaatttaagaataaaacaatagtctttaatcaatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40953311689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttggaaaaaataaaacaatagaatttaagggatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40953411689650303ctagcagaagaagaggtagtaattagatctgccaatttctcggacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagacgtatacgtataggaccagggagagcagtttgtgcagcagataaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaaaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40953511689650303ctagcagaagaagaggtagtaattagatctgccaatttctcggacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccaacaacaatacaagcagacgtatacgtataggaccagggagagcagttattgcagcagataaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaaaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40953611689650303ctagcagaagaagaggtagtaattagatctgccaatttctcggacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccaacaacaatacaagcagacgtatacgtataggaccagggagagcagtttatgcagcagataaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaagaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40953711689650303ctagcagaagaagaggtagtagttagatctgccaatttctcagacaatgctaaaaacataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaggatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40953811689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaaccataatagtgcaactgaacaaatctatagaaattaattgtacaagacccagcaacaatacaaacagaagtatacatttaggactagggagagcatttgaggcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaggatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40953911689650303ctagcagaagaagaggtagtaattagatctgccaatttctcggacaatgctaaaaacataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttgggaaaaataaaacaatagaatttaagggatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40954011689650303ctagcagaagaagaggtaataattagatctgccaatttctcagacaatgctaaaaacataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttggaaaaaataaaacaatagaatttaagggatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40954111689650303ctagcagaagaagaggtagtaattagatctgccaatttctcggacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagtgcattttatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaacacatagttgaaaaattaagagaacaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40954211689650303ctagcagaagaagaggtagtagttagatctgccaatttctcgaacaatgctaaaaacataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatccatataggaccagggaaagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaacaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40954311689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaaacataatagtgcagctgaacaaatctatagaaattaattgtacaagacccaacaacaatacaagcagacgtatacgtataggaccagggagagcagttattgcagcagataaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaaaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40954411689650303ctagcagaagaagaggtagtaattagatctgccaatttcacgaacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaggtataaatataggaccagggagagcatttattacaacagaaagaataacaggagatataagacaagcacattgtaacattagtagagcagattggaataagactttacaacagatagttgaaaaattaagagaaaaatttggaaataataaaacaatagtctttaagtcatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40954611689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaatcataatagtacagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatccatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaagaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40954711689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaatcataatagtgcaactgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaagaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40954811689650303ctagcagaagaagaggtagtaattagatctgccaatttctcggacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccaacaacaatacaagcagacgtatacgtataggaccagggagagcagttattgcagcagataaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaaaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40954911689650303ctagcagaagaagaggtaataattagatctgccaatttctcagacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttggaaaaaataaaacaatagaatttaagggatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40955011689650303ctagcagaagaagaggtagtaattagatctgccaatttcacgaacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaggtataaatataggaccagggagagcattttatacaacagaaagaataacaggagatataagacaagcacattgtaacattagtagagcagattggaataagactttacaacagatagttgaaaaattaagagaacaatttgggaataataaaacaatagtctttaatcaatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40955111689650303ctagcagaagaagaggtagtaattagatctgccaatttcacgaacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaggtataaatataggaccagggagagcattttatacaacagaaagaataacaggagatataagacaagcacattgtaacattagtagagcagattggaataagactttacaacagatagttgaaaaattaagagaacaatttgggaataataaaacaatagtctttaatcaatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40955211689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaaacataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatacaacagaaaaaataacaggagatataagacaaacacattgtaaccttagtagaacagactggaataagactttacaccacatagttgaaaaattaagagaacaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40955311689650303ctagcagaagaagaggtaataattagatctccgaatttctcagacaatgctaaaaacataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagaatggaataagactttacaccacatagttgaaaaattaagagaagaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40955411689650303ctagcagaagaagaggtagtaattagatctgccaatttctcagacaatgctaaaaacataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40955511689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagacgtatacatataggaccagggagagcatttgatgcaacagatagaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaacacatagttgaaaaattaagagaacaatttggaaataataaaacaatagtctttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40955611689650303ctagcagaagaagaggtagtaattagatctgccaatttctcagacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40955711689650303ctagcagaagaagaggtaataattagatctgccaatttctcagacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40955811689650303ctagcagaagaagaggtagtaattagatctgccaatttctcggacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccaacaacaatacaagcagacgtatacgtataggaccagggagagcagttattgcagcagataaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaaaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40955911689650303ctagcagaagaagaggtagtagttagatctgccaatttctcgaacaatgttaaaaacataatagtacagctgaacaaatctatagaaattaattgtacaaggcccagtaacaatacaagcagaagtatacatataggaccagggagggcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaagaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40956011689650303ctagcagaagaagaggtagtaattagatctgccaatttctcggacaatgttaaaaacataatagtgcagctaaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttgggaaaaataaaacaatagaatttaagggatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40956111689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaaacataatagtgcaactgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40956211689650303ctagcagaagaagaggtagtagttagatctgccaatttctcggacaatgctaaaaacataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaatgagactttacaccacatagttgaaaagttaagagaagaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40956311689650303ctagcagaagaagaggtagtaattagatctgccaatttctcggacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccaacaacaatacaagcagacgtatacgtataggaccagggagagcagttattgcagcagataaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaaaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40956411689650303ctagcagaagaagaggtaataattagatctgccaatttctcggacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccaacaacaatacaagcagacgtatacgtataggaccagggagagcagttattgcagcagataaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaaaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40956511689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaaatataatagtgcagctaaacaaatctatagaaattaattgtacaaggcccagtaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40956611689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaaatataatagtgcagctaaacaaatctatagaaattaattgtacaaggcccagtaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcttggaataagactttacaccacatagttgaaaaattaagagaagaatttggaaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40956711689650303ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaaaatataatagtgcagctaaacaaatctatagaaattaattgtacaagacccaacaacaatacaagcagacgtatacgtataggaccagggagagcagttattgcagcagataaaataacaggagatataagacaagcacattgtaaccttagtagaacagattggaataagactttacaccacatagttgaaaaattaagagaaaaatttgggaaaaataaaacaatagaatttaagagatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40956811689650303ctagcagaagaagaggtagtaattagatctgccaatttcacgaacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaggtataaatataggaccagggagagcattttatacaacagaaagaataacaggagatataagacaagcacattgtaacattagtagagcagattggaataagactttacaacagatagttgaaaaattaagagaacaatttgggaataataaaacaatagtctttaagcaatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40956911689650303ctagcagaagaagaggtagtaattagatctgccaatttcacgaacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaggtataaatataggaccagggagagcattttatacaacagaaagaataacaggagatataagacaagcacattgtaacattagtagagcagattggaataagactttacaacagatagttgaaaaattaagagaacaatttgggaataataaaacaatagtctttaatcaatcctcagga
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40957011689650303ctagcagaagaagaggtagtacttaggtctgccaatttctcggacaatgctaaaaccataatagtgcagctgaacaaatctatagaaattaattgtacaagacccagcaacaatacaagcagaagtatacatataggaccagggagagcatttgatgcaacagaaaaaataacaggagatataagacaagcacattgtaaccttagtagaacagcaaggaataagactttacaccacatagttgaaaaattaagagaagaatttggaaaaaataaaacaatagaatttaagggatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40957111689650300ctagcagaagaagagatagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaatgatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40957211689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaataaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataactatgagaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaatttcgaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40957311689650303ctagcagaagaagaggtagtaattagatcagaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatgcaagaaaaagtatacctatgggaccaggcaaaacattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagaacaaagtggaataaaactttaaaacagatagctatgaagttaagagaacaatttggaaataataaaacaatagcctttaatcactcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40957411689650303ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaaacattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagctataaagttaagagaacaatttggaaataataaaacaatagcctttaatcactcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40957511689650303ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaaacattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagctataaagttaagagaacaatttggaaataataaaacaatagcctttaatcactcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40957611689650303ctagcagaagaagaggtagtaattagatcagaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaaacattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagctatgaagttaagagaacaatttggaaataataaaacaatagcctttaatcactcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40957711689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagccgaataaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtataactatgagaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaatttcgaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40957811689650303ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaaacattttatgcaacaggagacataataggagatataaggcaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaatttggaaataataaaacaatagcctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40957911689650303ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagacataataggagatataagacaagcacattgtaacattagtagaaaacaatggaataaaactttaaaacagatagctataaagttaagagaacaatttggaaataataaaacaatagcctttaatcactcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40958011689650300ctagcagaagaagagatagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtatacctattggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaagttaagagaacaatttgggaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40958111689650303ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacgagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaatttggaaataataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40958211689650303ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagacataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaatttggaaataataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40958311689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggaaacataagacaggcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaatttgggaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40958411689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggaaacataagacaggcacattgtaacattagtagaacaagatggaataacactttaaaacagctagttataaagttaagagaacaatttgggaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40958511689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggacccggcaaagcattttatgcaacaggagacataataggaaatataagacaagcacactgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaatttgggaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40958611689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacangaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaatttggaaataataaaacaataatctttaatcaatcctca
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40958711689650303ctagcagaagaagaggtagtaattagatccgaaaatttcgcgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaatttggaaataataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40958811689650303ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaactgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaatttggaaataataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40958911689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtacagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggtaaagcattttatgcaacaggagatataataggaaatataagacaggcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaatttgggaataaaacaataatctttaatcaaccctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40959011689650303ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaaaacataatagtgcagctgaatgaaactgtagaaattaattgtacaaggcccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaatttggaaataataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40959111689650300ctagcagaagaagaggtagtaattagatcggaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40959211689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40959311689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagacataagacaagcacattgtaacattagtggaacaaaatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40959411689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40959511689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaagacagatagttataaaattaagagaacaatttgggaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40959611689650300ctagcagaagaagaggtagtaagtagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaagacagatagttataaagttaagagaacaatttggaaataaaacaatgatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40959711689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40959811689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaagacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40959911689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttatagtagtacagctaaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40960011689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcgcattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40960111689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacgaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataaggcaagcacattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40960211689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcatttgatgcaacaggagatataataggagatataagacgagcacattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40960311689650300ctagcagaagaagaggtagtaattagatccgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaaaatggaataaaactttaaaacagatagttataaagttaagagaacaatttggaaataaaacaatagcctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40960411689650300ctagcagaagaagaggtggtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaaaatggaataacactttaaaacagatagttataaagttaagagaacaatttggaaataaaataataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40960511689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaatttggaaataaaacaatgatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40960611689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctaaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaagacagatagttataaaattaagagaacaatttgggaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40960711689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtatacctatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaagttaagagaacaatttggaaataaaacaatgatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40960811689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaataatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttggaaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40960911689650300ctagcagaagaagaggtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtggaacaagatggaataacactttaaaacagatagttataaaattaagagaacaatttgggaataaaacaataatctttaatcaatcctcagga
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40961011689650300ctagcagaagaagaagtagtaattagatctgaaaatttcacaaacaatgctaaagttataatagtacagctgaatgaaactgtagaaattaattgtacaagacccaacaacaatacaagaaaaagtataactatgggaccaggcaaagcattttatgcaacaggagatataataggagatataagacaagcacattgtaacattagtagaacaagatggaataaaactttaaaacggatagttataaaattaagagaacaatttgggaataaaacaataatctttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40961111689650300ctagcagaagaagaggtagtaattagatcccaaaattttacggacaatgctaaagtcataatagtacagctgaatgaatctgtagtgattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagcaaaatggaatgacactttaaaacagatagttataaagttaagagagcaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40961211689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgctaaagtcataatagtacagctaaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40961311689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctacaagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40961411689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacggacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggaaatataagacaagcatattgtgaagtgagtagagcagaatggaataacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40961511689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40961611689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacggacaatgctaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40961711689650303ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaggacccaacaacaatacaagaaaaagtatacatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcatattgtaatgtgagtagagcagaatggaagaacactttaaaacagatagttccaaagttaagagaacaatttgggaataataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40961811689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaataacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacagataagacaagcatattgtgaagtgagtagggtagaatggaataacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40961911689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40962011689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacggacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacagtttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40962111689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaataacaatacaagaaaaagtatacatataggtccaggcagggcattttatgcaacaggagaaataataggagagataagacaagcatattgtgaagtgagtagggcagaatggaataacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40962211689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaataacaatacaagaaaaagtatacatataggtccaggcagggcattttatgcaacaggagaaataataggagaggtaagacaagcatattgtgaagtgagtagggcagaatggaataacactttaaaacagatagttctaaagttaaaagaacattttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40962311689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacggacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtataagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacagaagaaataataggagaaataagacaagcatattgtagccttagtagagcaaaatggagtaacactttaaaacagatagttataaagttaagagaacaatttaagaataaaacaatagtctttaagcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40962411689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaatgacaatacaagaaaaagtacacatataggtccaggcagggcattttacgcaacaggagaaataataggagagataagacaagcatattgtgaagtgagtagggcagaatggaataacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40962511689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacggacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtataagacccaacgacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacagaagaaataataggagaaataagacaagcatattgtagccttagtagagcaaaatggagtaacactttaaaacagatagttataaagttaagagaacaatttaagaataaaacaatagtctttaagcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40962611689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaataacaatacaagaaaaagtatacatataggtccaggcagggcattttatgcaacaggagaaataataggagagataagacaagcatattgtgaagtgagtagggcagaatggaataacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40962711689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacggacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtataagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacagaagaaataataggagaaataagacaagcatattgtagccttagtagagcaaaatggagtaacactttaaaacagatagttataaagttaagagaacaatttaagaataaaacaatagtctttaagcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40962811689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacggacaatgccaaggtcataatagtacagctgaatgaatctgtagtaattaattgtataagacccaacaacaatacaagaaagagtatacatataggaccaggcagggcattttatacaacagaagaaataataggagaaataagacaagcatattgtagccttagtagagcaaaatggagtaacactttaaaacagatagttataaagttaagagaacaatttaagaataaaacaatagtctttaagcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40962911689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacggacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacatatgggaccaggcagggcattttatacaacaggagaaataatagggcagataagacaagcatattgtgaagtgagtagggcagaatggaataacactttaaaacagatagttctaaagttaagagaacaatttgggaataaaacaagagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (B) (No)AF40963011689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaataacaatacaagaaaaagtatacatataggtccaggcagggcattttatgcaacaggagaaataataggagagataagacaagcatattgtgaagtgagtagggcagaatggaataacactttaaaacagatagttctaaagttaagagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40963111689650300ctagcagaagaagaggtagtgattagatcccaaaatttcacgaacaatgctaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacagagaggaccaggcagggcattttatacaacaggagaaataacaggagatataagaaaagcacattgtaatgtgagtagagcaaaatgggataacactttaaaacagatagctctaaagttaggagaacaatttgggaataaaacaatagtctttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40963211689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgctaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacacataggaccaggcagggcattttatacaacaggagaaataacaggagatataagaaaagcacattgtaatgtgagtagagcaaaatgggagaacactttaaaacagatagctctaaagttaggagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40963311689650300ctagcagaagaagaggtagtgattagatcccaaaatttcacgaacaatgctaaagccataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataacaggagatataagaaaagcacactgtaatgtgagtagagcaaaatgggagaacactttaaaacagatagctctaaagttaggagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40963411689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgctaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggacaaataataggagatataagaaaagcatattgtgaagtgaatagagcagaatggaagaacactttaaaacagatagctctaaagttaggagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40963511689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgctaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacacataggaccaggcagggcattttatacaacaggagaaataacaggagatataagaaaagcacattgtaatgtgagtagagcaaaatgggagaacactttaaaacagatagctctaaagttaggagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40963611689650300ctagcagaagaagaggtggtaattagatcccaaaatttcacgaacaatgctaaggtcataatagtacagctaaatgaatctgtagtaatcaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggacaaataataggagatataagacaagcatattgtgaagtgaatagagcagaatggaagaacactttaaaacagatagctctaaagttaggagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40963711689650300ctagcagaagaagaggtagtaattagattccaaaatttcacgaacaatgctaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataacaggagatataagaaaagcacattgtaatgtgagtagagcaaaatgggagaacactttaaaacagatagctctaaagttaggagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40963811689650303ctagcagaagaagaggtagtaattagatcccaaaatttcacggacaatgctaaagtcataatagtacagctgaataaatctgtagtaattaattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggacaaataataggagatataagacaagcatattgtaatgtgagtagagcagaatggaagaacactttaaaacagatagttccaaagttaagagaacaatttgggaataataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40963911689650303ctagcagaagaagaggtagtgattagatcccaaaatttcacgaacaatgctaaagtcataatagtacagctgaatgaatctgtagtaattaattgtgcaagacccaataacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggacaaataataggagatataagacaagcatattgtaatgtgagtagagcagaatggaagaacactttaaaacagatagttccaaagttaagaggacaatttgggaataataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964011689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctatgagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964111689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964211689650300ctagcagaagaaggggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatatagggccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964311689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacggacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaataacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggaccgataagacaagcatattgtgaagtgagtagggcagaatggaataacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964411689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaataacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaataatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964511689650300ctagcagaagaagaggtagtaattagatccaaaaatttcacggacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaataacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggaccgataagacaagcatattgtgaagtgagtagggcaggatggaataacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964611689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggtagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaataatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964711689650300ctagcagaagaagaggtaataattagatcaaaaaatttcacggacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattaattgtacaagacccaataacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggaccgataagacaagcatattgtgaagtgagtagggcagaatggaataacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964811689650300ctagcagaagaagaggtagtaattagatcccaaaatttcgcgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggcagggcattttatacaacaggagaaataataggacctataagacaagcatattgtagccttagtagagccaaatggaatgacactttaaaacagatagttataaagttaagagaacaatttaagagtaaaacaatagtttttaatcaatcctcagga
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungTat (gp160)B (B) (No)AF40964911689650300ctagcagaagaagaggtagtaattagatcccaaaatttcacgaacaatgccaaagtcataatagtacagctgaatgaatctgtagtaattgattgtacaagacccaacaacaatacaagaaaaagtatacatataggaccaggtagggcattttatacaacaggagaaataataggacctataagacaagcctattgtagccttagtagagccaaatggaatgacactttaaaacagatagttctaaagttaaaagaacaatttgggaataaaataatagtttttaatcaatcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40965011689650300ctagcagaagaagaggtagtaattcggtcagccaatttctcggacaatgctaaaagcataatagtacagctaaatgaagctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaagttaagagaacaatttaagaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40965111689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcggacaacgctaaaagcataatagtacagctaaatcaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttagaaaagatagttgaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40965211689650300ctagcagaagaaggggtagtaattcggtcagccaatttctcggacaacgctaaaagcataatagtacagctaaatgaagctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttagaaaagatagttaaaaaattaggggaacaatttaagaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40965311689650300ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaaattaggggaacaatttaagaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40965411689650300ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaaattaggagaacaatttaagaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40965511689650297ctagcagaagaaggggtagtaattaggtcagccaatttctcggacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatgggataacactttagaaaagatagttagcaaattaagagaacaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40965611689650297ctagcagaagaaggggtagtaattcgatcagccaatttctcggacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaataacactttacaaaagatagttgaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40965711689650297ctagcagaagaaggggtagtaattcggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatgaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttagaaaagatagttgaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40965811689650300ctagcagaagaagaggtagtaattcggtcagccaatttctcggacaacgctaaaagcataatagtacagctaaatgaagctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttacaaaggatagttaaaaaattaggggaacaatttaagaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (#) #AF40965911689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatcaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcagaatggaatgacactttagaaaagatagttgaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonTat (gp160)B (B) (No)AF40966011689650303ctagcagaagaagaggtagtaattagatcagccaatttctcggacaatgctaaaatcataatagtacagctaaatgaacctgtaaaaattaattgtacaagacctagcaacaatacaagaagaagtatacatatgggaccaggcaaagtattttatgcaacagaagacataacaggagatataagacaagcacattgtaacattagtagagaaaaatggaataacactttaggacagatagttaaaaaattaagaaaacaatttgggaaggataaaacaataatctttaatcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40966111689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaagttaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40966211689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagataatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaagttaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40966311689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40966411689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagataatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaagttaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40966511689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaagttaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40966611689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40966711689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40966811689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagataatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaagttaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40966911689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagataatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaagttaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40967011689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainTat (gp160)B (#) #AF40967111689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaaggaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40967211689650300ctagcagaagaagaggtagtgattagatctgccaatttctcgaacaatgctaaaaacataatagtacagctaaatgaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattctatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttagaaaagatagttagaaaattaaaagaacaatttaagaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40967311689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatcaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcagaatggaatgacactttagaaaagatagttgaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40967411689650300ctagcagaagaagaggtagtaattggctcagccaatttctcggacaacgctaaaagcataatagtacaactaaatgaagctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaaattaggggaacaatttaagaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40967511689650300ctagcagaagaagaggtagtaattaaatctgccaatctctcgaacaatgctaaagtcataatagtacagctaaataaatctgcagaaattaattgtacaagacccaacaacaatataaaaataagaagtatacacataggaccaggccgaccattttatacaggagaaacaagaggaaggataagacaagcacattgtaatattagtagagcacaatggaatgacactttaacatggctagttggagaattaagagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40967611689650300ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaagtcataatagtacagctaaataaatgtgcagaaattaattgtacaagacccaacaacaatataaaaataagaagtatacacataggaccaggccgaccattttatacaggagaaacaagaggaaggataagacaagcacattgtaatattagtagagcacaatggaatgacactttaacatggctagttggagaattaagagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40967711689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatcaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcagaatggaatgacactttagaaaagatagttgaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40967811689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatcaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttttacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcagaatggaatgacactttagaaaagatagttgaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40967911689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatcaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcagaatggaatgacactttagaaaagatagttgaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40968011689650300ctagcagaagaagaggtagtaattagatctgccaatttctcgaacaatgctaaagtcataatagtacagctaaataaatctgcagaaattaattgtacaagacccaacaactatataaaaataagaagtatacacataggaccaggccgaccattttatacaggagaaacaagaggaaggataagacaagcacattgtaatattagtagagcacaatggaatgacactttaacatggctagttggagaattaggagaacaatttaagaataaaacaatagtctttaatcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40968111689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatgaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaagagatagttaaaaaattaggggaacaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40968211689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatcaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcagaatggaatgacactttagaaaagatagttgaaaaattaggagaaaaatttaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) *AF40968311689650300ctagcagaagaagaggtagtaattagatcagccaatttctcggacaatgctaaaatcataatagtacagctaaatgaatctgtaaaaattaattgtacaagacctagcaacaatacaagaagaagtatacatatgggaccaggcagtgcattttatgcaacagaagacataacaggagatataagacaagcacattgtaacattagtagagcaaaatggaataacactttaggagacatagtaaaaaaattaggaaaacaatttaagaataaaacaataatctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (B) (No)AF40968411689650300ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatgaatctgtagtaattaattgcacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacaccttaaaagagatagttaaaaaattaggggaacaatttaagaataaaacaatagtctttactcactcctcagga
NA369HIVEUnknown SexIV Drug UserUnknown Viral Load23 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeTat (gp160)B (#) #AF40968511689650297ctagcagaagaagaggtagtaattaggtcagccaatttctcagacaatgctaaaagcataatagtacagctaaatcaatctgtagtaattaattgtacaagacccagcaacaatacaagaagaggtatacatataggaccaggcagtgcattttatacaacaggagaagtaacaggagatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttagaaaagatagttgaaaaattaagagaaaaatttaataaaacaatagtctttactcactcctcagga
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40968611689650390gggggaaagaaaaaatatagtacaaaacatatagcatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40968711689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagttacagccatcccttcagacaggatcagaagaacttagatccttatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaagagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcgcctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40968811689650390gggggaaagaaaaaatatagtacaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcgggaggctgtagacaaatattggaacagttacagccatcccttcagacaggatcagaagaacttaaatccttatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40968911689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggaactagaacgatttgcagtcaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagttacagccatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtgcttcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40969011689650390gggggaaagaaaaaatatagtacaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagttacagccatcccttcagacaggatcagaagaacttagatccttatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaagaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40969111689650390gggggaaagaaaaaatatagattaaaacatatagtctgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacagccatcccttcagacaggatcggaagaacttagatcgttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaggacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacataaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40969211689650390gggggaaagaaaaaatatagtacaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcgggaggctgtagacaaatattggaacagttacagccatcccttcagacaggatcagaagaacttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40969311689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggaactagaacgatttgcagtcaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagttacagccatcccttcagacaggatcagaagaacttagatccttatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctgtagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40969411689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattgggacagttacagccatcccttcagacaggatcagaagaacttagatccttatataatacagtagcaaccctctattgtgtgcatcaaaggatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcggcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40969511689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggaactagaacgatttgcagtcaatcctggcctattagaaacatcaggaggctgtaaacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatctttatataatacagtagcaaccctctattgtgtgcatcaaaagataaatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40969611689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagataaatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacttgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40969711689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcggcagccggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40969811689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggaactagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtaaacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatctttatataatacagtagcaaccctctattgtgtgcatcaaaagataaatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40969911689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagttacagccatcccttcagaccggatcagaagaacttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagccggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40970011689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatactgaaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtacatcaaaagatagaagtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40970111689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtaaacaaatattggaacagttacagccatcccttcagacaggatcggaagaacttagatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaagagtaaaaaaaaggcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40970211689650390gggggaaaaaaaaaatatagattaaaacatatagcatgggcaagcagggaactagaacgatttgcagttaatcctggcctattagaaacatcaggaggctgtaaacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatctttatataatacagtagcaaccctctattgtgtgcatcaaaagataaatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40970311689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagttacagccatcccttcagacaggatcggaagaacttagatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaagagtaagaaaaaggcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40970411689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttagatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40970511689650390gggggaaagaaaaaatatagattaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagttacagccatcccttcagacaggatcggaagaacttagatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagataaaggaagagcaaaacaagagtaaaaaaaaggcacagcangcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40970611689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaatcatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacctgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40970711689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacagccatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacctgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40970811689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaatcatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcccaggaaacagcagccagatcagccaaaattaccctatagtgcagaacctgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40970911689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccagatcagccaaaattaccctatagtgcagaacctgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40971011689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaatcatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccagatcagccaaaattaccctatagtgcagaacctgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40971111689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaatcatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccccatagtgcagaacctgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40971211689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagagacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacctgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40971311689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaatcatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaagatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacctgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA284HIVEUnknown SexIV Drug UserUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40971411689650390gggggaaagaaaaaatatagattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagagcttaaatccttatataatacagtagcaaccctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacctgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40971511689650390gggggaaagaaaaaatataaattaaaacatatagcctgggcaagcagggagctagaccgattcgcagttaatcctggcctactagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcaaacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40971611689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaacgattctcaattaatcctggcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40971711689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaacgatacgcagttaatcctggcctactagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcaaacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40971811689650390gggggaaagaaaaaatataaattaaaacatgtagcatgggcaagcagggagctagaacgattctcaattaatcctggcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40971911689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40972011689650390gggggaaagaaaaaatataaattaaaacatatagcatgggcaagcagggagctagaacgatacgcagttaatcctggcctactagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcaaacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcaccaagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40972111689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatacaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcaccaagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40972211689650390gggggaaagaaaaaatataaattaaaacatatcgtgtgggcaagcagggagctagaacgattctcaattaatcctggcctattagaaacatcagaaggctgtagacaaatactggcacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattatgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40972311689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaacgatacgcagttaatcctggcctactagaaacatcaggnggctgtagacaaatattggaacagctacaaccatcccttcaaacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40972411689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaccgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40972511689650390gggggaaagaaaaaatatctattaaaacatatagtatgggcaagcagggagctagaacgattatcaattaatcctggcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacaacaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40972611689650390gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgatacgcagttaatcctggcctactagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcagaccatatcaccaagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40972711689650390gggggaaagaaaaaatacaaactaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatactggaacaactacaaccatctcttcagacaggatcagaagaacttaaatcattatttaatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacagaaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40972811689650390gggggaaagaaaaaatacaaactaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatactggaacaactacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacagaaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40972911689650390gggggaaagaaaaaatataatttaaaacatatagcatgggcaagcagggagctagaccgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40973011689650390gggggaaagaaaaaatacaaactaaagcatatagcatgggcaagcagggagctagaacgatttgcagttaaccctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagatcagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcaccaagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40973111689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatactggaacagctacaatcatcccttcagacaggatcagaagaacttaaatcattatataatacggtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatacaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40973211689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaacgatacgcagttaatcctggcctactagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcaaacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40973311689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaacgattctcagttaatcctggcctattagaaacatcagagggctgtagacaaatactggcacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattatgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40973411689650390gggggaaagaaaaaatacaaactaaaacatataccatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatactggaacaactacaaccctcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacagaaaacagcagccaggacagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40973511689650390gggggaaagaaaaaatataaactaaaacatatagcatgggcaagcagggagctagaccgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatactagaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40973611689650390gggggaaagaaaaaatacaaactaaaacatatagcatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggccagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40973711689650390gggggaaagaaaaaatatctattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatattggcacagctacagccatcccttaaaacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgggtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaccagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40973811689650390gggggaaagaaaaaatatcaattaaaacatgtagtctgggcaagcagggagctagaacgattctcaattaatcctggcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40973911689650390gggggaaagaaaaaatatctattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatattggaacaactacagccatcccttcaaacaggatcagatgaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaccagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974011689650390gggggaaagaaaaaatatctattaaaacatatagtatgggcaagcagggagctagaacgattatcaattaatcctggcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaaacacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcaaaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974111689650390gggggaaagaaaaaatatctattaaaacattcaatatgggcaagcagggagctagaacgactcgcagttaatcctggcctattagaaacatcagggggctgtagacaaatattggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccacggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974211689650390gggggaaagaaaaaatatctattaaaacatatagtatgggcaagcagggagctagaacgattatcaattaatcctagcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcagcagctggcacaggacacagcagccaggtcagccaaaattaccctatagtacagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974311689650381gggggaaagaaaaaatatctattaaaacatatagtatgggcaagcagggagctagaacgattatcaattaatcctggcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcagcagctggcagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974411689650390gggggaaagaaaaaatatctattaaaacatatagtatgggcaagcagggagctagaacgattatcaattaatcctggcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974511689650390gggggaaagaaaaaatatcaattaaaacatgtagtatgggcaagcagggagctagaacgattctcaattaatcctggcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaaaatagatgtaaaagacaccaaggaagctttagacaaaatagaggaagagcaaaacaaaagtaaggaaaaggcacagcaagcagcagttggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974611689650390gggggaaagaaaaaatataaattaagacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagggggctgtagacaactactagaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagataccacggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccagggacaaatggtacatcaggccatatcacctagaactttaaat
NA116Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load4 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974711689650390gggggaaagaaaaaatatctattaaaacatatagtatgggcaagcagggagctagaacgattctcaattaatcctggcctattagaaacatcagagggctgtagacaaatactgacacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaggaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacccagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974811689650390gggggaaagaaaaaatatcaattaaaacatgtagtatgggcaagcagggagctagaaagattcgcaattaatcctggcctgttagaaacatcggaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaagttaaatcattatttaatacagtagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagagaaggtagaggaagagcaaaacaaaagtaaaggaaaaacacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcaaaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40974911689650390gggggaaagaaaaaatatcaattaaaacatgtagtatgggcaagcagggagctagaaagattcgcaattaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaagttaaatcattatttaatacagtagcaactctctattgtgtacatcagaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtacagaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40975011689650390gggggaaagaaaaaatatcaattaaaacatgtagtatgggcaagcagggagctagaaagattcgcaattaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaagttaaatcattatttaatacagtagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaccaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcaaaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40975111689650390gggggaaagaaaagatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcccgttagaaacatcagaaggttgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattattcaatacagtagcaactctctactgtgtacatcaaagaatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaagcaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40975211689650390gggggaaagaaaaaatatcaattaaaacatgtagtatgggcaaacagggagctagaaagattcgcaattaatcctggcctgttagaaacatcaggaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaagttaaatcattatttaatacagtagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40975311689650390gggggaaagaaaaaatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacatcaaagaatagatgtaaaagacaccaaggaagctttagagaagatagaagaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccgtatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40975411689650390gggggaaagagaaaatatcaattaaaacatctagtatgggcaagcagggagttagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacatcaaagaatagatgtaaaagacaccaaggaagctttagagaagatagaagaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcagaacattcaggggcaaatggtacaccaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40975511689650390gggggaaagaaaaaatatcaattaaaacatttagtatgggcaagcagggagctagaaagattcgcaattaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaagttaaatcattatttaatacagtagcaactctctattgtgtacatcaaagaatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcaaaacattcagggacaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40975611689650390gggggaaagaaaaaatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattattcaatacagtagcaactctctattgtgtacatcaaagaatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaagcaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacattcagggacaaatggtacatcaggccatatcacctagaacgttagat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40975711689650390gggggaaagaaaaaatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaagaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40975811689650390gggggaaagaaaaaatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacaatagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagaggagatagaggaagagcaaaccaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcagaacattcagggacaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40975911689650390gggggaaagaaaaaatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagagaaggtagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctgacacaggaaataacagccaggtcagccaaaactaccctatagtgcaaaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40976011689650390gggggaaagaaaaaatatcaattaaaacatgtagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacaatagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaccaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40976111689650390gggggaaagaaaaaatatcaattaaaacatgtagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacgaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaaataaggaaaaaacacagcaagcagcagctgacacaagaaacagcagccaggtcagccaaaattaccctatggtgcagaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40976211689650390gggggaaagaaaaaatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacaccaaagaatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaagcaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40976311689650390gggggaaagaaaaaatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaactcattatttaatacagtagcaactctctactgtgtacatcaaagtctagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaagcaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagagctttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40976411689650390gggggaaagaaaagatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctgttagaaacatcagagggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacatcaaagaatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40976511689650390gggggaaagaaaagatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaagcaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcaaaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40976611689650390gggggaaagaaaaaatatcaattaaaacatctagtatgggcaagcagggagctagaaagattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatattgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacatcaaagaatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaagcaaaagtaagaaaaaagaacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagagccttcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA371Unknown HAND StatusMHomosexualUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40976711689650390gggggaaagaaaaaatatcaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgagacagctacaaccatccattgagacaggatcagaagaaattaaatcattatttaatacagtagcaactctctattgtgtacatcaaaggatagatgtaaaagacaccaaggaagctttagagaaaatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctgacacaggaaatagcagccaggtcagccaaaattaccctatagtgcagaacattcagggacaaatggtacatcaggccatatcacctagaacttcaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40976811689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40976911689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaaaaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977011689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaaaaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977111689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatccattaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977211689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcaccggaaacaacagccaggtcagccaaaattaccctatagtacagaacatgcagggacaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977311689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaaggtagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcaactggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977411689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcagggacaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977511689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcaactggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977611689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacagcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacactaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977711689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcaactggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcagggacaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977811689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcaactggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40977911689650390gggggaaagaaaaaatacaaactaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcagagggctgtagacaaatactgggacagctacaaccatcccttgagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcaactggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978011689650390gggggaaagaaaaaataccaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacagcagaaggctgtagacaaatactggaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatataatacagtagcaatcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978111689650390gggggaaagaaaaaatacaaactaagacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagagggctgtagacaaatactagaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagccaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978211689650390gggggaaggaaaaaatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacagcagagggctgtagacaaatactggaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaacaaagcacagcaagcagaagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcaggacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978311689650390gggggaaagaaaaaatacaaactaagacgtatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagagggctgtagacaaatactagaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978411689650390gggggaaagaaaaaatacaaactaagacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagagggctgtagacaaatactagaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaaaacggcacagcaagcagcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978511689650390gggggaaagaaaaaatacagactaagacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagagggctgtagacaattactagaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978611689650390gggggaaagaaaaaatacaaactaagacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagagggctgtagacaaatactagaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaaaaaagcacagcaagcagcagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978711689650390gggggaaagaaaaaatacaaactaagacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagagggctgtagacaaatactagaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaacaaagcacagcaagcagcagctggcacaggaaacagcaaccaggtcagccaaaattaccctatagtgcagaacatgcaagggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978811689650390gggggaaagaaaaaataccaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacagcagaaggctgtagacaaatactggaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatacaatacagtagcaaccctttattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaacaaagcacagcaagcagaagctggcacaggaaacaacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40978911689650390gggggaaagaaaaaataccaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacagcagagggctgtagacaaatattggaacagctacaaccatcccttaagacagaatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagaagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979011689650390gggggaaagaaaaaatacaaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggtctattagaaacagcagagggctgtagacaaatactggaacagctacaaccagcccttaagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979111689650390gggggaaagaaaaaatacaaattaaaacatatagtatgggcaagcggggagctagaacgattcgcagttaatcccggtctattagaaacagcagagggctgtagacaaatactggaacagctacaaccagcccttaagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979211689650390gggggaaagaaaaaatacaaattaaaacatatagtatgggcaagcagggagctagaacgatttgcagttaatcccggcctattagaaacagcagagggctgtagacaaatattggaacagctacaaccatcccttaagacaggatccgaagaacttagatcattatataatacagtagcgaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagcagctggcacaggaaataacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979311689650390gggggaaagaaaaaatacaaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacagcagagggctgtagacaaatactggaacagctacaaccagcccttaaaacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagaagctggcacaggaaataacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979411689650390gggggaaagaaaaaatacaaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcccggtctattagaaacagcagagggctgtagacaaatactggaacagctacaaccagcccttaagacaggatcagaagaacttagatcattatataatgcagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcgggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979511689650390gggggaaagaaaaaatatcaattaaaacatatagtatgggcaagcagggggctagaacgctttgcagttaatcccggcctattagaaacagcagagggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaacaaagcacagcaagcagaagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979611689650390gggggaaagaaaaaatacaaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacagcagagggctgtagacaaatactggaacagctacaaccagcccttaaaacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaacaaagcacagcaagcagcagctggcacaggaaataacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979711689650390gggggaaagaaaaaatacaaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacagcagagggctgtagacaaatactggaacagctacaaccagcccttaaaacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaacaaagcacagcaagcagcagctggcacaggaaataacagccaggtcagccaaaattaccccatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979811689650390gggggaaagaaaaaatataaactaaaacatatagtatgggcaagcaaggagctagaacgattcgcagttaatcctggcctattagaaacagcagaaggctgtagacaaatactggaacagctacaaccagcccttaaaacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaacaaagcacagcaagcagcagctggcacaggaaataacagccaggtcagccaaaattaccctatagtgcagaacatgcaagggcaaatggtacatcaggccatatcacctagaactttaaat
NA425Unknown HAND StatusUnknown SexIV Drug UserUnknown Viral Load1 cell / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40979911689650390gggggaaagaaaaaatacaaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacagcagagggctgtagacaaatactggaacagctacaaccagcccttaaaacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagacaagatagaggaagaacaaaacaaaagtaagaacaaagcacagcaagcagcagctggcacaggaaataacagccaggtcagccaaaattaccctatagtgcagaacatgcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980011689650390ggaggaagaaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980111689650390ggaggaagaaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagctacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980211689650390ggaggaagaaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980311689650390ggaggaagaaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgtatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980411689650390ggaggaagaaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980511689650390ggaggaagaaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980611689650390ggaggaagaaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttagaaacaccagaaggccgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980711689650390ggaggaagaaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980811689650390ggaggaagaaaaaaatatcaattaagacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttaggaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagattgatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40980911689650390ggaggaagaaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacggttcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaatagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaaaccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981011689650390ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagagataagagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccccatagtgcagaatctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981111689650390ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcaatcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatcagtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagagataagagacaccaaggaagctttagagaagatagaggaagaacaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaatctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981211689650390ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcaggaaactagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttatatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagagataagagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaatctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981311689650390ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttatatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaggacaccaaggaagctttagataagatagaggaagaacaaaacaaaagtaagaaaaagacacggcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaatctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981411689650390ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagaacaaaacaaaagtaagaaaagggcacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaatctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981511689650390ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcaatcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatcagtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagaacaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaatctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981611689650390ggaggaaagaaaagatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaatctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981711689650393ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagaacaaaacaaaagtaagaaaaaggcacagcaagcagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccccatagtgcaaaacctccaggggcaaatggtacaccaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981811689650390ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcaatcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatcagtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtgaaagacaccaaggaagctttagagaagatagaggaagaacaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaatctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40981911689650393ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcaatcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatcagtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982011689650393ggaggaaggaaaagatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcaatcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcggaacctccaggggcaaatggtacaccaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982111689650390ggaggaaagaaaagatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagttctctattgtgttcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaatcttcaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982211689650390ggaggaaagaaaagatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagagataagagacaccaaggaagctttagataagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacaccaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982311689650393ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcaaggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagcagctgacacaggaaacagcagccatgtcagccaaaattaccctatagtgcaaaatctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982411689650390ggaggaaagaaaagatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacaatagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagaacaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaacctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982511689650390ggaggaaagaaaagatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagctatatccgtcccttcagacaggatcagaagaacttaaatcattatataatgcagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagaacaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaacctccaggggcaaatggtacaccaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982611689650393ggaggaaggaaaaaataccaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagctatatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaaccttcaggggcaaatggtacaccaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982711689650393ggaggaaagaaaagatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttatatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcagcaagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaacctccaagggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982811689650393ggaggaaggaaaaaatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacaattatatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtacatcaaaagatagagataagagacaccaaggaagctttagagaagatagaggaagaacaaaacaaaagtaagaaaaaggcacagcaagcagcagcagctgacacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
NA20Unknown HAND StatusMHomosexualUnknown Viral Load8 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40982911689650393ggaggaaagaaaagatatcaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacaccagaaggctgtcaacaaatattgggacagttacatccgtcccttcagacaggatcagaagaacttaaatcattatataatacagtagcagtcctctattgtgtgcatcaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagcagctgacacaggaaacagcagtcaggtcagccaaaattaccctatagtgcagaacctccaggggcaaatggtacatcaagccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983011689650420gggggaaagaaagaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcctttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983111689650420gggggaaagaaaaaatatcaattaaaacatatagtatgggcaagcagggagctagaaagattcgcaattaatcctggcctgttagaaacatcagcaggttgtagacaaatactgggacagctacaaccagcccttcagacaggatcagaagaacttaaatcattatataatacagtagcaaccctctattgtgtacatcaaaatatagaggtaaaagacaccaaggaagctctagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacagaaaacagcagccagattagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983211689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggagcaactacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcacgtagcgcaggaaacagcagcgaggtcagccaaaattaccctatagtgcggaacctacagggacaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983311689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaagattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983411689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacaccaaggaagctctagataagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983511689650420gggggaaagaaaaaatacaagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggtctgttagagacatcagaaggctgcagacaaatattggaacagctacaaccagccattaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcgcaggaaacagcagccaaatcagccaaaattaccctatagtgcgaaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983611689650420gggggaaagaaaaaatacaagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggtctgttagagacatcagaaggctgcagacaaatattggaacagctacaaccagccattaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcgcaggaaacagcagccaaatcagccaaaattaccctatagtgcgaaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983711689650420gggggaaagaaaaaatacaagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggtctgttagagacatcagaaggctgcagacaaatattggaacagctacaaccagccattaagacaggatcagaagaacttaaatcattatttaatacagtagcaatcctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcgcaggaaacagcagccaaatcagccaaaattaccctatagtgcgaaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983811689650420gggggaaagaaaaaatacaagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggtctgttagagacatcagaaggctgcagacaaatattggaacagctacaaccagccattaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaggacaccaaggaagctctagacaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcgcaggaaacagcagccaaatcagccaaaattaccctatagtgcgaaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40983911689650420gggggaaagaaaaaatacaagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggtctgttagagacatcagaaggctgcagacaaatattggaacagctacaaccagccattaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcgcaggaaacagcagccaaatcagccaaaattaccctatagtgcgaaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984011689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagagacatcagaaggctgcagacaaatattggaacagctgcaaccagccattaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagaggtaaaagacaccaaggaagctctagataagatagaggaagagcaaaacaaaagtaagaaaagagcacagcaagcagcagccgacacaagaaacaacaaccaggccgcagctagcacagaaaacagcagccagattagccaaaattaccctatagtgcggaacctacagggacaaatggtacatcaggccatatcacctagaactttaaac
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984111689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccagcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaagggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctccagggacaaatggtacatcaggccatatcacctagaactttaaac
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984211689650420gggggaaagaaaaaatatcaattaaaacatatagtatgggcaagcagggagctagaaaaattcgcaattaatcctggcctgttagaaacatcagaaggttgtagacaaatactgggacagctacaaccagcccttcagacaggatcagaagaacttaaatcattatataatacagtagcaaccctctattgtgtacatcaaaatatagaggtaaaagacaccaaggaagctctagataagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagaagctgacacaggaaacagcagccaggccgcagctggcacaggaaatagcaaccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984311689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaaaaattcgcaattaaccctggtctgttagaaacatcagaaggctgcagacaaatactggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcacaggaaacagcaaccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984411689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcacaggaaacagcaaccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984511689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaaccctggtctgctagaaacatcagaaggctgcagacaaatactggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagaggtaaaggacaccaaggaagctctagacaaaatagagaaagagcaaaacaaaagtaggaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984611689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaaaaattcgcaattaatcctggcctgttagaaacatcagaaggctgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgcgcatcaaaagatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctagcacagaaaacagcaaccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984711689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaaaaattcgcaattaatcctggcctgttagaaccatcagaaggccgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaagggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctgacacaggaaacaacagccaggtcagccaaaattaccctatagtgcggaacctccagggacaaatggtacatcaggccatatcacctagaactttaaac
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984811689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaaaaattcgcaattaatcctggcctgttagaaccatcagaaggccgtagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaagatagaggtaaaggacaccaaggaagctctagacaaaatagagaaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgagaaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40984911689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaaaaattcgcaattaaccctggtctgttagaaacatcagaaggctgcagacaaatactggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagtagctgacacaggaaacaacaatcaggccgcagctggcacagaaaacagcagccaggtcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985011689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaggacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaggacaccaaggaggctctagataagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacgacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985111689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctctagataagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacgacagccaggcagcagctggcacaggaaacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985211689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagaggtaaaagacaccaaggaggctctagataagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985311689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcggaagaacttaaatctttatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctctagataagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaagt
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985411689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcgggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985511689650420gggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatctttatttaatacagtagcaaccctctattgtgtgcatcaaaggatagaggtaaaagacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985611689650420gggggaaagaaaaaatataagctaaaacatatagtgtgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985711689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaactgaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcgggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985811689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagttagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaact
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40985911689650420gggggaaagaaaaaatataagctaaaacatatagtgtgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatccattaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtacatcgaaggatagaggtaaaggacaccaaggaagctctagacataatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40986011689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattgtttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagacaccaaggaagctctagataaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggggacagcagccagatcagccaaaattaccctatagtgcggaacctacagggacaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40986111689650420gggggaaagaaaaaatataagctaaaacatatagtgtgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaggacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagactccaaggaagctctagataaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctatagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40986211689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagagacatcagaaggctgcagacaaatattagaacagctacaaccatcccttaggacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaagactccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaagacacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40986311689650420gggggaaagaaaaaatataagctaaaacatatagtgtgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacgacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40986411689650420gggggaaagaaaaaatataagctaaaacatatagtgtgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtacatcgaaggatagaggtaaaagacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggagacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctgtagtacggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40986511689650420gggggaaagaaaaaatataagctaaaacatatagtgtgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattagaacagctacaaccatcccttaggacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagataaaagcacagcaaacagcagctgacacaggaaacaacagccaggccgcagctagcgcaggaaacagcagccaaatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40986611689650420gggggaaagaaaaaatataagctaaaacatatagtgtgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaggacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaagggcaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggagacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40986711689650420gggggaaagaaaaaatataagctaaaacatatagtgtgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40986811689650420gggggaaagaaaaaatataagctaaaacatatagtgtgggcaagcagggagctagaacgattcgcagtcaatcctggcctgctagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtaacaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcataggagacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40986911689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaggacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacgacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
UK1_NA21HIVEUnknown SexIV Drug UserUnknown Viral Load87 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40987011689650420gggggaaagaaaaaatataagctaaaacatatagtatgggcaagcagggagctagaacgatttgcagtcaatcctggcctgttagaaacatcagaaggctgcagacaaatattggaacagctacaaccatcccttaagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcgaaggatagaggtaaaggacaccaaggaagctctagacaaaatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacaacagccaggccgcagctggcacaggaaacagcagccagatcagccaaaattaccctgtagtgcggaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40987111689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40987211689650381gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40987311689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggaggctgtagacaaatactggaacagctacaaccagcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccacaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40987411689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaaagcacaacaagcagcggctggcacaggaaacagcagccaggtcggccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40987511689650390ggggtaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaaagcacaacaagcagcggctggcacaggaaacagcagccaggtcggccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40987611689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaacaaaagtaagcaaaaagcacaacaagcagcggctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40987711689650390gggggaaagaaacaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaaagcacaacaagcagcggctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40987811689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaaagcacaacaagcagcggctggcataggaaacagcagccaggtaagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40987911689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaaagcacaacaagcagcggctggcataggaaacagcagccaggtaagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40988011689650381gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccagcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaactctctattgtgtgcatcaaaggatagatgtaagagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacagcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40988111689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)ColonGag (p17)B (B) (No)AF40988211689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctcttagaaacatcaggcggctgtaggcaaatactggaacagctacaaccagcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaggatagatataaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccataattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40988311689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttgatcctggcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtagcaaccctctattgtgtgcaccaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagcaaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40988411689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagagcgactcgcagttaatcctggcctattagaaacagcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttcgatcattatttaatacagtagcaaccccctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaacgcacaacaagcagcggctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40988511689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacagcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttcgatcattatttaatacagtagcaaccctctatcgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaacgcacaacaagcagcggctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40988611689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacagcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttcgatcattatttaatacagtagcaaccctctatcgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaacgcacaacaagcagcggctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40988711689650390gggggaaagaaaaaatataaattaaaacatctagtgtgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacagcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttcgatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaacgcacaacaagcagcggctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40988811689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacagcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttcgatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaacgcacaacaagcagcggctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40988911689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacggcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttcgatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaacgcgcaacaagcagcggctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40989011689650390gggggaaagaaaaaatataaattaaaacatctagtgtgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacagcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttcgatcattatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaacgcacaacaagcagcggctggcacaggaaacagcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40989111689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcattatttaatacagtagcaaccctctattgtgtgcaccaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagcaaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)BrainGag (p17)B (B) (No)AF40989211689650399gggggaaggaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtagcaaccctctattgtgtgcaccaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgactcaggaaacagcagccaggccagccaggtcagcaaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40989311689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagagagctagaacgattcgcagttaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacaactacaaccagcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcagtcctctattgtgtgcatcaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgatacaggaaacagcagccaggccaaccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40989411689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcaacagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactctaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40989511689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctcttagaaacatcaggcggctgtagacaaatactggaacagctacagccatcccttcagacaggatcagaggaacttaaatcattatttaatacagtagcagtcctctattgtgtgcatcaaaggatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaagaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagcaaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40989611689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggcggctgtaggcaaatactggagcagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcagtcctctattgtgtgcatcaaaggatagatataaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaggcacagcaagcagcagctgacacaggaaacagcagccagaccagccaggtcagcaaaaattaccctatagtacagaatatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40989711689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcccggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaggatagatataaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaagaaagcacagcaagcagcagctgacacaggaaacagcagtcaggccagccaggtcagcagaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40989811689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatcgatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcgcctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40989911689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgatttgcagttaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcagtcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcaacagctgacacaggaaacagcagccaagtcagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40990011689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaggatagatataaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcaacagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40990111689650399gggggagagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacggttcgcagttaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttaaatcattatttaatacagtagcaatcctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcaacagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)Lymph NodeGag (p17)B (B) (No)AF40990211689650399gggggaaagaaaagatataaattaaaacatctagtatgggcaagcagagagctagaacgattcgcagttaatcctggcctattagaaacatcaggcggctgtaggcaaatactggaacagctacaaccatcccttcagaccggatcagaagaacttaaatcattatttaatacagtagcagtcctctattgtgtgcatcaaaggatagatataaaagacaccaaggaagctttagagaagatagaggaagaacaaaacaaaagtaagaaaaaagcacagcaagcaacagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttgaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40990311689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcaaggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctgtagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40990411689650399gggggaaagaaaaagtataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattagaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttggagaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40990511689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacagccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40990611689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaataaaagtaagcaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40990711689650399gggggaaagaaaaaatataaattaaagcatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggtctattagaaacatcaggcggttgtaggcaaatactggaacagctacaaccatcccttcagacaggaccagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacagggaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40990811689650399gggggaaagaagaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagttgcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40990911689650390gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctattggaaacatcagaaggctgtagacaaatactggaacagctacaaccatcccttcagacaggattagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccagaattaccctatagtgcagaacattcaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40991011689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagttaaccctggcctattagaaacatcaggcggctgcaggcaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagaaaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40991111689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcccttcagacaggatcagaagaacttagatcagtatttaatacagtggcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
NA25HIVEUnknown SexHeterosexualUnknown Viral Load297 cells / ulUnknown Therapy StatusUnknown Therapy StatusUnknown Patient AgeDeceased2001United Kingdom (Edinburgh)LungGag (p17)B (B) (No)AF40991211689650399gggggaaagaaaaaatataaattaaaacatctagtatgggcaagcagggagctagaacgattcgcagtcaatcctggcctattagaaacatcaggcggctgtagacaaatactggaacagctacaaccatcctttcagacaggatcagaagaacttaaatcagtatttaatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagctttagagaaaatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagctgacacaggaaacagcagccaggccagccaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccatatcacctagaactttaaat
MACS2HIVE + HADMHomosexualUnknown Viral Load52 cells / ulAZTUnknown Therapy StatusUnknown Patient AgeDeceased2001United States (Chicago)Spleen(gp120)B (#) #AF4148881158137681aacaataatacaagaaaaaggatgagtctaggtccagggaaagtattttatacaacaggacaaataataggagatataaga
MACS1HIVE + HADMHomosexualUnknown Viral Load2 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Brain(gp120)B (B) (No)AF41488911581376375aaattaaccccactctgtgttactttaaattgcagtgatgtaaatggcactagtagtaataccactagagagataagaaatgagacaataatggaaaaaggagaagtgaaaaactgctctttcaatatcaccacaagcataagagatagggtgcagaaacaatatgcaacattttatagacttgatgtagtgcaaatagatgataatgataatactaggtataggatggcaagttgtaacgcctcagtcattacacaggcctgtccaaagatatcctttgagccaattcccatacatttttgtgccccggctggttttgcgattctaaagtgtacagaaaaggggttcaatggaacaggaaaatgtaaaaatgtc
MACS1HIVE + HADMHomosexualUnknown Viral Load2 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Brain(gp120)B (B) (No)AF41489011581376375atattaaccccactctgtgttactttaaattgcagtgatgtaaatggcactagtagtaataccactagagagataagaaatgagacaataatggaaaaaggagaagtgaaaaactgctctttcaatatcaccacaagcataagagatagggtgcagaaacaatatgcaacattttatagacttgatgtagtgcagatagatgataatgataatactagttataggatgacaagttgtaacgcctcagtcattacacaggcctgtccaaagatatcctttgagccaattcccatacatttttgtgccccggctggttttgcgattctaaagtgtacagaaaaggggttcaatggaacaggaaaatgtaaaaatgtc
MACS1HIVE + HADMHomosexualUnknown Viral Load2 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Brain(gp120)B (B) (No)AF41489111581376375aaattaaccccactctgagttactttaaattgcagtgatgtaaatggcactagtagtaataccactagagagataagaaatgagacaataatggaaaaaggagaagtgaaaaactgctctttcaatatcaccacaagcataagagatagggtgcagaaacaatatgcaacattttatagacttgatgtagtgcagatagatgataatgataatactagttataggatgacaagttgtaacgcctcagtcattacacaggcctgtccaaagatatcctttgagccaattcccatacatttttgtgccccggctggttttgcgattctaaagtgtacagaaaaggggttcaatggaacaggaaaatgtaaaaatgtc
MACS1HIVE + HADMHomosexualUnknown Viral Load2 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Spleen(gp120)B (B) (No)AF41489211581376375aatttaaccccactctgtgttactttaaattgcagtgatgtaaatggcactagtagtaatatcactagaaagataagaaacgagacaataatggaaaaaggagaaatgaaaaactgctctttcaatattaccacaggtatgagagatagggtgcagaaacaatatgcaacattttatagacttgatgtagtacaaatagatgataaggataagactagatataggatgacaagttgtaatgcctcagtcattacacaggcctgtccaaagatatcctttgagccaattcccatacatttttgtgccccggctggttttgcgattctaaagtgtaaagaaaaggggttcaatggaacaggaaaatgtaaaaatgtc
MACS1HIVE + HADMHomosexualUnknown Viral Load2 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Spleen(gp120)B (B) (No)AF41489311581376375aaattaaccccactctgtgttactttaaattgcagtgatgtaaatggcactagtagtaataccgctaaaaacataagaaacgagacaataatggagaaaggagaaatcaaaaactgctctttcaatatcaccacaggcataagagatagggtgcagaaacaatatgcaacattttatagacttgatgtagtacaaatagatgataagcataagactagatataggatgacaagttgtaatgcctcagtcattacacaggcctgtccaaagatatcctttgagccaattcccatacatttttgtgccccggctggttttgcgattctaaagtgtaaagaaaaggggttcaatggaacaggaaaatgtaaaaatgtc
MACS1HIVE + HADMHomosexualUnknown Viral Load2 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Spleen(gp120)B (B) (No)AF41489411581376375atattaaccccactctgtgttactttaaattgcagtgatgtaaatggcactagtagtaataccgctaaaaacataagaaacgagacaataatggagaaaggagaaatcaaaaactgctctttcaatatcaccacaggcataagagatagggtgcagaaacaatatgcaacattttatagacttgatgtagtacaaatagatgataagcataagactagatataggatgacaagttgtaatgcctcagtcattacacaggcctgtccaaagatatcctttgagccaattcccatacatttttgtgccccggctggttttgcgattctaaagtgtaaagaaaaggggttcaatggaacaggaaaatgtaaaaatgtc
MACS2HIVE + HADMHomosexualUnknown Viral Load52 cells / ulAZTUnknown Therapy StatusUnknown Patient AgeDeceased2001United States (Chicago)Brain(gp120)B (B) (No)AF41489511581376351aaattaaccccactctgtgttactttaaattgctctgacttgaataccactagtagtaacggggaaataagggagagaggagaaataaaaaactgctctttcaatatcaccacaagcatgacagataagatgcagaaagaatattcacttttttataaacttgatgtagtaccaatagataatagtaatactagctataggttgataagttgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgagccaattcccatacattattgtgccccggctggttttgcgattctaaaatgtaataataaaaagttcaatggaacaggaccatgtaaaaatgtc
MACS3HIVE + HADMHomosexualUnknown Viral Load95 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Brain(gp120)B (B) (No)AF41489611581376360aaattaaccccactctgtgttactttaaattgcactaatttgaaaaatgctacttataccaatagtagtagttgggaagggatgaaggaagaaataaagaactgctctttcaatatcaccacaaacataggaaataagatgaagaaagattatgcactttttaataaacttgatgtagtaccaacaggggatggtaatacaagctatatgttaataaattgtaacacctcagccattacacaggcctgtccaaaggtatcctttgaaccaattcccatacattattgtgccccagctggttttgcgattctacaatgtaatgataagaagttcaatggaacaggaccatgtacaaatgtc
MACS3HIVE + HADMHomosexualUnknown Viral Load95 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Brain(gp120)B (B) (No)AF41489711581376351aaattaactccactctgtgttactttaaattgcattaatgcaaatactactaatagtagtatttgggaagggatgaaggaagaaataaagaactgctctttcaatataaccacaaacataaaaaagaagctaaagagagaatatgcactttttaataaacttgatgtagtaccaacaggggatagtaatacaagctatatgttaataaattgtaacacctcagccattacacaggcctgtccaaaggtatcctttgaaccaattcccatacattattgtgccccagctggttttgcgattctacaatgtaatgataacaagttcaatggaacaggaccatgtacaaatgtt
MACS3HIVE + HADMHomosexualUnknown Viral Load95 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Brain(gp120)B (B) (No)AF41489811581376351aaattaactccactctgtgttactttaaattgcattaatgcaaatactactaatagtagtatttgggaagggatgaaggaagaaataaagaactgctctttcaatataaccacaaacataaaaaagaagctaaagagagaatatgcactttttaataaacttgatgtagtaccaacaggggatagtaatacaagctatatgttaataaattgtaacacctcagccattacacaggcctgtccaaaggtatcctttgaaccaattcccatacattattgtgccccagctggttttgcgattctacaatgtaatgataacaagttcaatggaacaggaccatgtacaaatgtt
MACS3HIVE + HADMHomosexualUnknown Viral Load95 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Lymph Node(gp120)B (B) (No)AF41489911581376351aaattgactccactctgtgttactttaaattgcattaatgcgaatactactaatagtagtatttgggaagggatgaaggaagaaataaagaactgctctttcaatatcaccacaaacataaaaaagaagttaaagagagaatatgcactttttaataaacttgatgtagtaccaacaggggatagtaatacaagctatatgttgataaattgtaacacctcagccattacacaggcctgtccaaaggtatcctttgaaccaattcccatacattattgtgccccagctggttttgcgattctacaatgtaatgataacaagttcaatggaacaggaccatgtacaaatgtt
UK1_NA21HIVE + HADFIV Drug UserUnknown Viral Load87 cells / ulddC1Unknown Patient AgeDeceased2001United Kingdom (Edinburgh)Brain(gp120)B (B) (No)AF41490011581376399aaattaaccccactctgtgttactttaaattgcactgatgctaatttcaatagcactgatgtgaagaatgctactaataccactgcttctaataccactagtagtagcgggggaatgatggaggcaggagaaataaaaaattgctctttcaatattaccacacgcctaagagataaggtgcagaaagaatatgcacttttttataaacttgatgtagtaccaataggaaaggataatactagctataggttgataagttgtgacacctcaaccgttacacaggcctgtccaaaggtatcctttgagccaattcccatacattattgtaccccggctggttttgcgattataaagtgtaatgataagaagttcaatggaacaggaacatgtacaaatgtc
MACS1HIVE + HADMHomosexualUnknown Viral Load2 cells / ulNo Therapy0Unknown Patient AgeDeceased2001United States (Chicago)Brain(gp120)B (#) #AF4149011158137681aacaacaatacaagaaaaagtatgagtctaggtccagggaaagtattttatacaacaggacaaataataggagatataaga
MACS1HIVE + HADMHomosexualUnknown Viral Load2 cells / ulNo Therapy</