HIV Sequence

tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt

Close window