View Detailed Record Patient: Code Patient: HAND Status Patient: Sex Patient: Risk Factor Patient: Viral Load At Sampling Patient: CD4 Count At Sampling Patient: HIV Therapy Status Patient: HIV Therapy Months Patient: Age At Sampling Sampling: Year Sampling: Country (City) Sampling: Tissue Sequence: Polyprotein (Protein) Sequence: Genotyping Information* Sequence: Accession Number Sequence: PMID HIV Sequence
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001137 10076507 tgtacaagacccaacaacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001138 10076507 tgtacaagacccaataacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagac... more
tgtacaagacccaataacaatacaagaaaaggtataaatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001139 10076507 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagaggattattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagaggattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001140 10076507 tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001141 10076507 tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagat... more
tgtacaagacccaacaacaatacaagaaaaggtatacgtataggaccagggagagcagtattttatgcaacagatataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001142 10076507 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcagtattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001143 10076507 tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcagtattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001144 10076507 tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcattattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtatacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001145 10076507 tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcattattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtgtacatataggaccagggagagcattattttatgcaacagacataataggagatataagacaagcacattgt
View SUBJECT_4 HIVE + ADC M Unknown Risk Factor Unknown Viral Load 5 cells / ul AZT 20 29 1993 Japan (unknown) Spleen Tat (gp160) B (#) # AB001146 10076507 tgtacaagacccaacaacaatacaagaaaaggtgtatatataggaccagggagagcagtattttatgcaacagac... more
tgtacaagacccaacaacaatacaagaaaaggtgtatatataggaccagggagagcagtattttatgcaacagacataataggagatataagacaagcacattgt
There are no records to display
Create filter